SSO11102

Coordinates:2526875-2527039

>SSO11102 55 aa !not a gene!
MLARTSWAAKPNTNPAKPPAANAVPKLTLISTKNPTNAMIYPISLTTNEILLALS

>SSO11102 55 aa !not a gene!
ATGTTGGCAAGAACGTCTTGGGCAGCTAAACCTAACACTAATCCCGCGAAACCACCAGCAGCTAACGCAGTACCCAAACT
TACCCTAATTAGTACAAAGAATCCTACGAATGCTATGATATATCCAATTAGTCTAACTACAAATGAAATACTGCTAGCGT
TATCG


Sulfolobus solfataricus P2

Sequence spaning coordinates : 2526375 - 2527539 (Additional range around SSO11102 is :500nt.)

>Sulfolobus solfataricus P2 TTCTCTTACTGTCCTCATAACTATTTTTAGTATTTCGCTTCTTGGAGGTTCTTCATATATAGTTTTACAGATCGTATCTA TTCCTAAAATGTATGTGTTTAATGTAGTTTCAAGCACTTTAATTGAAGGTTCTTCGATTACGAAATCCAGTTTCTTTATT TTTTCCTTAAGAACGTTAATTAAAACATCTGGATCTATATCCTTGGAGACTTCATACTTAGTTCTGACCTTCCTTTTCTC CTCCCCATTATGAATGAAAATTGCAGCTTGAATCATTATACTATTAGGTATCTTTACTGGAATCTGGTCGTCTGTAAATA TTGTAGTATAAAGTAATGAAATGTCTGTTACTGTACCGGTGTAACCTGGGATCAAAAAATCATTAGAGAAGAACTTTGGA GGATAGGTTGGAGCTAATAAACCATATTGCCACGTTGATACCGTCACTCTGTCTCCTACCTTATATGGCCTAGAAATCAC TATCATTATCCCGCCGAAT ATGTTGGCAAGAACGTCTTGGGCAGCTAAACCTAACACTAATCCCGCGAAACCACCAGCA GCTAACGCAGTACCCAAACTTACCCTAATTAGTACAAAGAATCCTACGAATGCTATGATATATCCAATTAGTCTAACTAC AAATGAAATACTGCTAGCGTTATCG TAACCTATTACATCTCCTAATCTATTCCTAATAAGAGAGCCTATAAAGTACGAA ACAATAACCGCAACTATAAACCAAATTGCAGCGTAAATATAGAGTAGATAATCAGCAGGTATTATCTTAAATACGCTGGA TAGTACGAAAACACCACCGCCGAGTGCTATTCCAGCTAATACTACAGTTAAGATGAGTGCTATTACTCTTCTTTCGTTTA AAGCCATAGTATTACCTTTTGGATAATCGTTTATATTGTTTATGTTTAAAGTTACTTTGTAGATTTATCGAATTTTTATA AGGATTTAAGGATTATTACAGATCTAAATTAAATATCTGATCATCTATCGAAATAAATATATTAGTATTTAATATAAAAG TATTCAATTTAACAACAAAGCAGTCTAAAATAGGAAAAATAGTCATCCTCACAATGCTAACTAATCCTTATTATCCTAGA ATGCTATTTTATTACATGGGTTATAAATCTCGTCTTTACCATGTTA