SSO11110

Coordinates:2530048-2530194

>SSO11110 49 aa !not a gene!
MIQRRFSIIHLLLIQRRFSSWLLITRLTARRLIMNLQRNLTFLLSSQTR

>SSO11110 49 aa !not a gene!
ATGATCCAGAGAAGATTTTCTATTATCCACCTATTACTAATCCAGAGAAGATTTTCCTCTTGGCTGTTAATTACAAGGCT
CACGGCAAGGAGACTAATAATGAACCTCCAAAGGAACCTTACATTTTTACTAAGTTCTCAAACGCGT


Sulfolobus solfataricus P2

Sequence spaning coordinates : 2529548 - 2530694 (Additional range around SSO11110 is :500nt.)

>Sulfolobus solfataricus P2 ACTTCCTAAGGTTAAATCAGAAAATGAGATATGGAAATACTTTTACAACTGATGTATTTCAAATAGATTACACTAAGGTT GTGGAAGGGATTGGGGTTAACGTAATTGAGGTTAAGGATAGGAAAGACCTTAAGAAAAGTGTAGAAGAGGCCGTTGGATT ATCTCTCAAGAGTCCAACAGTTCTAAGAGTTCACGTTAGCCCTAATAGTATACCTTCTAGATTGTTAATGAAAAGATAGT TATTTATATTAAAAATAAGGAGTTTTACCTATGGTTAAAATCCTATTATTCTCTCCAAATCCTAACGAATTTAAGAGAGT TGGTGTTTATGAGAACGGTAGGGTCATTGACCTAGTAAAGGCTTATGAACTATTATATGACGCTAAGCCCCCAAATTGGT TTTACGATACTAAGGATTTAATTGAAGGTGGAAATGGCTCAATCTTACTGATAAAGAGTGTTTTGGATAGTTTAAGGGGT AAGGAGGACAAAGTGTCTT ATGATCCAGAGAAGATTTTCTATTATCCACCTATTACTAATCCAGAGAAGATTTTCCTCT TGGCTGTTAATTACAAGGCTCACGGCAAGGAGACTAATAATGAACCTCCAAAGGAACCTTACATTTTTACTAAGTTCTCA AACGCGT TAATCGGTCATAATCAACCTATACTGTATCCGAAAGCATCAAATAAGGTTGATTACGAAATTGAGCTAGGAG TTATAATTGGGAAACAAGGGAAGTATGTAAAGAGAGAAAGAGCGTTTGATTACGTATTTGGTTATACAGTGTTCAACGAT ATTAGTTATAGGGATAGACAATTTCCATCAGAAATGCCCTATGGTATGAGGTGGGTTCACGGTAAGGGTATGGACACTGG AGCACCAATGGGACCGTGGATAGTTACCAAGGATGAAATTCCAAACCCTTATGAATTGAGGTTGACTTTAAGAGTTAACG GGGAAGTTAGGCAAGACGCTTACGCTGAGGACATGATATTTAAGATTGATGAGATAATCGAGTATTTGTCAAATGGTATA ACATTAAAACCTGGAGATATAATATCTACTGGAACTCCGCCTGGAGTTGGATTAGCTACTGGAAAATTCTTGAAACCGGG CGATACAATTGAGGCGGAGATAAGCAAG