SSO11225

Coordinates:2577829-2577948

>SSO11225 40 aa !not a gene!
MPIGILSPHSILFSIALLILSSISSGFLTIGSQLGSSSNL

>SSO11225 40 aa !not a gene!
ATGCCAATTGGTATTCTATCTCCCCATTCCATACTCTTCAGTATAGCCTTACTCATCTTATCATCCATTTCCTCTGGCTT
CTTAACTATAGGATCCCAACTTGGATCTTCATCTAACTTG


Sulfolobus solfataricus P2

Sequence spaning coordinates : 2577329 - 2578448 (Additional range around SSO11225 is :500nt.)

>Sulfolobus solfataricus P2 TTTAGCTCCATATCTCTCCTTTAATCTAACAGCTTCTTCTATTGCATGTAAATCTGGAGGATTAATAACAGCTGGTACTC CTTCCCTTACCAAATTATTAGTTACCGGGTCAATCCTTAATTCATCCACATCTGGAACTTGCTTTATTGAAACAACAACT TTGAGTTCCGGCAATTCTACCTCTATAATGAATGTTCTTGATAGTTTTTAAGATTTCACAAAAAAGGATGTAATTTAAAG TCCTTAAGTAGAAAGTATAAACTAGTCCCTTTGTTGAAAGGGTTTATTAAACCAAGATAAAAATTGTGAAAGAGATAAAA AAGAAAAAAGTGATATTATATCTTATGTTACTCTTCTTTCCTTCAAAATATCTTCAACATCAGTAGTTGGTTTCCCTTCG AATTCTATTACATCATGAGCCGGTGGGTTATCCAAATATGATGGGGATCTTTCAGCAATTCTTTGCTCGTAAGTTGATAC TAATTCATTTTGATAGAAT ATGCCAATTGGTATTCTATCTCCCCATTCCATACTCTTCAGTATAGCCTTACTCATCTTA TCATCCATTTCCTCTGGCTTCTTAACTATAGGATCCCAACTTGGATCTTCATCTAACTTG TAAACCCTCTTATCATAAT ACTCTTTGGTGTGAATATCGTTATAAGTTGGACAAGGTTGTAATACATCAATCATTGCTAGTCCCTTATGCTTAATAGCC TTCTTTATTATCTCCTTCAAATGTTTCACGTCATAAGCATAACCCCTAGCTACGAAAGTGTATCCAGAACTAATTGCAAG AGCTATCGGATTAATATCTGAATTAATATTGGGTTTTGGTAAACTCTTAGTCTTAACACCTAATTTTAACGTAGGTGAAG CTTGACCCTTAGTTAATCCATAAACACCATTATTATGAACTATTACAGTTAAATCTACATTCCTCCTTCCAGCACTTACG AAATGTCCAACACCAATACCTAATTGATCTCCATCCCCACCATTCACAATAACCTCTAAAGAGGGATTAGCAAGTTTTAT TCCAATGGCGAAAGTTAATGCTCTGCCGTGCAATGTATGCACTCCACTAGCTGGTAACCTAATAAAGTGAGGGATTTTCC C