SSO6234

Coordinates:528745-528879

>SSO6234 45 aa !not a gene!
MTTTFSPSPSTNVSTPTFSIISSLHNHCHVEGPPTNIFIPLFLAS

>SSO6234 45 aa !not a gene!
TTGACTACTACCTTCTCTCCTTCACCATCTACTAACGTGTCTACGCCAACTTTTTCTATCATATCTTCTCTCCATAACCA
TTGCCATGTCGAAGGACCACCTACTAATATCTTCATTCCTCTCTTTTTAGCCTCT


Sulfolobus solfataricus P2

Sequence spaning coordinates : 528245 - 529379 (Additional range around SSO6234 is :500nt.)

>Sulfolobus solfataricus P2 ACTTGACAGAACCAGTTTCTATCCCTACCTCAACACCTAGATATCTTTGTTCATCATCAAATATTATCTCACCTAGCTTA CTAATTAAACCATATTTCTCCTCAGAGTATCTTATTGCCGCTAAACTTGCATGACTCCACGCTATTGTTTTATAATATTT CTTAACTAGCGTATGAAGTTTTATTAATGGTTCGGGTCTAGGATATATTCCTACTGCACCGTAAAATAGAACGTCATCAC TATGTACAACGCCATGTCTTACCCCTGCTCTAACATTAGTTTGCAATTCCTTTTCGATTTTTTCTAATGGATAATACCTA GTAGGTCTTATAGTAACTGAACAGAATCTGCAAGATCTTGCACATCCTCTCATTATTTCTATCATGCCATTGACGCTTGC TCCTTTAATCTCTGAAATATCGTCTATATCTGGCACATCGTCTCCGCTAACGTAAACGTACTTAGGCAATGGCTCATTAT CTAGTATCATTTGTGCTAAT TTGACTACTACCTTCTCTCCTTCACCATCTACTAACGTGTCTACGCCAACTTTTTCTAT CATATCTTCTCTCCATAACCATTGCCATGTCGAAGGACCACCTACTAATATCTTCATTCCTCTCTTTTTAGCCTCT TGA ATCTCCGGTTTGCTTATCAGAGCTTGGAAACTCTTGTAGTTTATTGGCTCCTTTTTAGTTATGCCCCACCAAGTTGATGA TGGTGGACCAAAAGCGAAGTAATCATGGTGCGAAAACATTAGGGCCTTAGCATATTTCAAGTGTCTATCTAAATGATCTG GATCTATTATTGCTGCCTTAAATCCTTCATCTATTAATTTAGCTTCGACTTTTCTCATTCCATATGGGGCTTGTTCTGGT CTTCCTAAATCGTCAACTTTCATTTTAGGGCATGCTAACCATTTCCAGACAGCTTCTGGAACTCCTACAGCAGGTCCAGT ACCTAAAAATCCAAGGAATTCTTTTCCATGATGATTCGTCATCAGACATCTATCTGTAGTTAATATGAAATCAAATGTCT GCTCCAAAAAACTCACCTATTTATTCTCACTCTTATAATCGTATATAAAAACCCTTTTTATAAAAGTTGTACTACTTTTC TAAAATTCTTCTTTAA