SSO6252

Coordinates:536207-536401

>SSO6252 65 aa !not a gene!
MTPSFSNLCEAPSCLSMITSASETLPPPLRISNVAFSMDTPVVATSSTNNTLFPFTSSSNVRLVP

>SSO6252 65 aa !not a gene!
TTGACTCCTAGTTTTTCCAATCTTTGTGAAGCCCCTTCTTGTCTATCTATGATTACTAGTGCGTCTGAAACTTTACCTCC
ACCGTTAAGAATCTCCAATGTTGCTTTCTCTATGGATACTCCTGTAGTTGCAACGTCATCTACTAACAATACTCTTTTTC
CTTTTACATCGAGTTCTAATGTACGATTAGTTCCA


Sulfolobus solfataricus P2

Sequence spaning coordinates : 535707 - 536901 (Additional range around SSO6252 is :500nt.)

>Sulfolobus solfataricus P2 CTTATAACGTTTTTAATATAGTCTGCGAATAACGTACTCCATCCTTCATGTGACATTACGGCAACTAAGTATAAATTTTT AGAGTTTGCATCAAGATATCTTTTTAATTCATCTAGAGATCCCTTAACGCCTATAAAGGAATGTGCTATGAACGAGTTGG CGAAAGATAATCTTTCAACTATGCTTTTCATTATGTATCCGATATCTGCAAGCTTAAAATCAACAATAATTTCCTCCACG TCTAAACCAATTAAGAGCTCTCTAGTTTTATCCACTCCTAGATCTAAAACTAAAGGTAAACCAACTTTTATCCCATATAA CTCATTTTCCATCTCTTTAAGAACTTGATATGAGAGAGGTTTATCCATTGCTAATATTACTCTACTTTTCAACATTCTTC ACCAAATAATCTAGAATTGACTTCTTTTCATTATCCTTAAGTTTATCACTCTTCAACAATTCATCTAGAATTTCTGAAAT TTTAAATAGAGAGTGTAAT TTGACTCCTAGTTTTTCCAATCTTTGTGAAGCCCCTTCTTGTCTATCTATGATTACTAGT GCGTCTGAAACTTTACCTCCACCGTTAAGAATCTCCAATGTTGCTTTCTCTATGGATACTCCTGTAGTTGCAACGTCATC TACTAACAATACTCTTTTTCCTTTTACATCGAGTTCTAATGTACGATTAGTTCCA TGACCTTTCTTTTCTATTCTAATA TATCCCATAGGCTCTTTAAGGTTACAAGCTATGAATGCCGATAAGGGAACTCCTCCAGTGGCTATTCCTACTATTATATC ATGGGGTATATCTTTTGCTTTCTTTATAGCTTGATTAACTATATCGTAAAATTCTGGATAATTTGGTAAAGGTCTTAAGT CTAAGTAATATGGACTAACCTTACCTGATGTTAAAACGAAACTTCCTATTAATAATAATTTCCTTTCGAGTAAGACTTCT GCGAAATTCATACGTAGAGACTCTGTGAAAAAGAATTTAAATATACTTCTATCATAACCAGTTATAAGGGCTTTGTGAGA TTAAGACACGTAGTTTCGTCGCTTGACTTGACCAGAGATGACTACTTTAGAATATTCGAACTTGCAGACAAGTTCTATGA TGTAAAAAAACTAAATTATCTATCAGGGAAAGTAGTTTCATTAGCATTCTTTGAGCCAAGTACTAGAACTGCTCAA