SSO6274

Coordinates:547702-547848

>SSO6274 49 aa !not a gene!
MHKSLLPIPCNISSTLRNSIESAFSSFPISFSDLLCAINSSLLGKSIPI

>SSO6274 49 aa !not a gene!
TTGCATAAGTCTCTTCTACCTATTCCTTGTAACATCTCTTCGACACTTAGAAATTCAATAGAATCAGCGTTCAGCTCATT
TCCTATTTCTTTTTCAGATTTATTATGCGCAATCAACTCTTCTCTTTTAGGAAAGTCTATTCCCATA


Sulfolobus solfataricus P2

Sequence spaning coordinates : 547202 - 548348 (Additional range around SSO6274 is :500nt.)

>Sulfolobus solfataricus P2 ACGGCTTAAGTCCTAGTTCGTCTCTATAGGCTATTAACTGGCCGTCTTTACTAATGGCTATGAACGAGATCGGCTTTTTA ATATCATCTATTGCATTTTCTGGCTCTCTTATGACATGGTTAAGAACATTGTTATCATCTATCATCCCATCAACGACTAT AGCACCATTATCTATTGTTATGGGATAACTATTTCTGATTCCAGCATAACCTATTCCAGCCCATCCATTCAAGTCTTTAA TTTCTAAATCCTCAGGCGCTACGTTCTCTAGTTTAGTAAATATATTCCTCTGCTTGTTCAATATTGCTATTCCACTTTTA GAATATCCTCTATGTTGCAAGCCTATTAGACCATAATATAAAAATCTAGATACATTCCATACATCATCGAACGCTAATAT ACCTAGTATTCCAGCCATTAATATCACTTCCCAAATATTCTTTCTAACTCTGTAGAATTATAGTTAAATTTGAGAGGATA AATCCCAGAAAAGCATGCA TTGCATAAGTCTCTTCTACCTATTCCTTGTAACATCTCTTCGACACTTAGAAATTCAATA GAATCAGCGTTCAGCTCATTTCCTATTTCTTTTTCAGATTTATTATGCGCAATCAACTCTTCTCTTTTAGGAAAGTCTAT TCCCATA TAACAAGGGTATTTTATCATAGGTGATCCTATACGTACATGAATTTCTTTGGCGCCGGCTTTACGTAACATA GTTATTATTCTCTTCATAGTATTTCCCCTAACTATTGAGTCGTCTATTAAAACTATTCTTTTCCCCCTTACTGCATCTGC AACCACTCCAAATTTCTCTTCTAATACCTCATTTCTCTTATCTTGAGTTGGCATTATGAAGGACCTTACAGAGGAAATTG TTCTAACTAGAGGTTCCTCTAAAGGTATGTGACTTTTTCTAGAAAAGCCCAGCGCTATTGGCCTTGATGAGTCCGGCACT GGAACTACAATATCTCCGTTAGCTGGGTGTTTTTCTGCTAATAATTCACCTAACCTTATCCTAGCTAAGTAAACTGAATG CCCATCTATATTGGAATCTGGTCTTGCAAAGTATATATATTCGAAGGAACAAGTAGCGTAATTTTTCTCCTCATAGATTA CTTTGTCATATAATATTTTGCCATTTTT