SSO9744

Coordinates:1921169-1921369

>SSO9744 67 aa !not a gene!
MVHLPSNLLLVLPRESSFPALSKLPSLLSSSAFSRKVSTLLFPGGKSSRKESTSHAMKSTRCALAGR

>SSO9744 67 aa !not a gene!
TTGGTCCACCTTCCCTCGAACCTCCTCTTGGTTCTCCCCAGGGAGAGCAGCTTCCCGGCCCTCTCCAAGTTACCTTCCCT
CCTCTCCAGCTCCGCCTTCTCCCGAAAGGTCTCCACGCTCCTCTTCCCAGGAGGTAAGTCCAGTAGGAAGGAGTCCACTA
GCCACGCCATGAAGTCCACGAGATGCGCGCTCGCAGGGAGG


Sulfolobus solfataricus P2

Sequence spaning coordinates : 1920669 - 1921869 (Additional range around SSO9744 is :500nt.)

>Sulfolobus solfataricus P2 AATATTAATATTGCCAGAAGGATAGGACCTGGATCACCGAGAAAAACTTTATAATGGAAAAATATCAAGACGAGAGGATT TACCTATCGCGCATAGCGTTGTCTGATCGCGAGGAGGTGCGTCTCAGAGCTGAACGGCTCTACGTTCTGGAGGAGTCCTC CGTTGGATCGCGAGGAATATCTTGATGTTGTAGATCACTCCCAGGACGTGAAGGAAGACGTCGTTCCTCCAAGTCGTAGT CCCGTAGGGCCTCCAGAACGCGTTCAGGTAGGTGCCGAAGAACTCCACGTGGGCCCTCAGGGTAGTGAAGGGCTTCTCCC GCGCTATGAGCTGTGTCGGGGAGGGAGAGAATCCCCTGTCCGCGATCTTAATCCCCTTGAGCGGTGACTTGAACCTCTTG TCCGAGAAGTTGGCTGGCTTCAACGTGATGGACCTCACGAAGAGGGAGACGGAGATCACGGCCACTGCCTTGAGCCCGTA GTGCGAGACCCCTCTCTTC TTGGTCCACCTTCCCTCGAACCTCCTCTTGGTTCTCCCCAGGGAGAGCAGCTTCCCGGCC CTCTCCAAGTTACCTTCCCTCCTCTCCAGCTCCGCCTTCTCCCGAAAGGTCTCCACGCTCCTCTTCCCAGGAGGTAAGTC CAGTAGGAAGGAGTCCACTAGCCACGCCATGAAGTCCACGAGATGCGCGCTCGCAGGGAGG TAACTGGGTAGGCACTTC TCCTCAAGCTTGAAGGAAATCTCCAACAACTTCTTCCTCACCCCGTACAACCTGCCCACGAAGTCGTGCAGCGTGCTCTT CCCCACCTTCCTCCCCACGAACCAGGCCACGACCACGTTCACGTTGACCATTTTCACCGCGTCCCTATAGGAGCAGGAAT AGAGCACCATGACGATTAACAACTTCAGGTAAACCAGCGCGCCCTCGCCAAGGACCCTCTCCAAATCCATGGCGTCCAGC ACGGGCTTGATCTCCGTTAACCATTTTTCCCTCCACGGCATATCCTCTATTGGGGGAAGAGGGTAGTACATCAGGTTTGG TATGTGTCTTAATGTTCTTGCCATGGTACTACCCTCTACTCCCATAACTTAAGTGTTACTCCAATTTAATCCAAGATAAT ACTAGAAACCAATTTATTCTTGCCAATAAAAATTCAATTTTTTACATTCCGGACACTCTCACGTGAAAATTGAAATTGGG AT