TRNA10

Coordinates:710583-710659

>TRNA10 Anticodon: TAA
GCCCCTATAGCCCAATTGGCAGAGGCAGCGGACTTAAAATCCGCGCAGTGTCGGTTCGAGTCCGACTGGGGGCACAA

>TRNA10 Anticodon: TAA
GCCCCTATAGCCCAATTGGCAGAGGCAGCGGACTTAAAATCCGCGCAGTGTCGGTTCGAGTCCGACTGGGGGCACAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 710083 - 711159 (Additional range around TRNA10 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GAACATGGGCTGCGTGCGGCTCACTGAGCGCTACCTGCACAGCAATCCGCCGACCGCGGAGGAAATCGCCGCGGCGGAGG ACTTCGTCGCCGAGCAGCTCCGAGAGGTGGAGGAGCACGTTGACCTCACTGGCGTGACTCGCCTGGTGGGCGTGGCCGGG ACCATGACCACCCTCAGCGCGATCACCCAGGGGGTGGATAGCTACCAGCCGGAGAAGATCCACTTGAGCCGACTGCCGCT GCGCACGTTCCGGAATACTGCCATCGACCTGCGGGATAAGACCGTCGACCAGCGACTCGAGTGCGGTCCCATGCACCCCG GCCGCGCGGACGTCGTTGGCGGTGGCGCGGTGGTCATCGACGCGGTAGCCAGCCGCTTCATGGCCCTCGGCGTCGAGGAG ATCACGATCAGTGAGAAAGACATCCTCGATGGTATGTTGGCAAAAGTTATGCGCCGCAACGGTGCCTAAAATCCGCGCGC GGTAGTGCGCGCGGGCACTA GCCCCTATAGCCCAATTGGCAGAGGCAGCGGACTTAAAATCCGCGCAGTGTCGGTTCGA GTCCGACTGGGGGCACAA AACAAAAGCTAGGCCGGAGAGCATTTCTCCCGCCTGGCTTCGTTATTGGTGCCGGTGGCTA TGCGCCGCCGCCACTAGTCGTTCTTTGCTGCCTTCTCGTCTTCCTTGGCAGCCTTTTCTTCGGCCTTGACGGCGGCCTTC TCGACCTTCTTCAGCTGCTTCTCGAGGTTGAAGTCCACCTCTGGCCACTCCAGCTTCATGTTCCGCAGCTCGTTGAGCAG CAGGTAGCGCACGACCAGGCGGGCGTAGTCCTGCGTATCACTAGGAATGATGTACCACGGGGCGACGTCGTTGGTCTTCT CGATGGCCCGGGCGTAGGCCTCGTGGTATTCATCCCACTTCTTCTGCACGCTGAGATCGCTGGGGGAGTAGCGCCAGCGC TGCGCCGGGTTGCGCAGGCGGGAGAGGAAGTTTTTGGTCTGGAACTGCGGGGAGATGTGCAGCAAGATTTTGATGACGCG GGTGCCGTCGGCCTCGAGCTGCTTCTCGAAGCGACGGA