TRNA11

Coordinates:829502-829574

>TRNA11 Anticodon: CCG
GCCTCCGTAGCTCAGGGGATAGAGCACTGGTTTCCGGTACCAGCGGTCGGACGTTCGAATCGTCTCGGGGGCA

>TRNA11 Anticodon: CCG
GCCTCCGTAGCTCAGGGGATAGAGCACTGGTTTCCGGTACCAGCGGTCGGACGTTCGAATCGTCTCGGGGGCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 829002 - 830074 (Additional range around TRNA11 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCAGGTTGATCTTCGTGCCCTTGTAGGCATCTCCGCGGCCGAAATCCTGGCCGGCGGCGAGAATATTCTCGACGATCTTG CCCTGCGCGGCGGCGGCCAGACGGATGTTAATAAAGCCAGGGCCGGCGACGCTGGCCTCGTCGATCTCCGGGCTAGCGGC CAGCTTCTCGGCGAGCCAGGTGCCTAGCTCACGGGGGTTCGTACCGGCCTTCTTGGCGGTCTGCATGGCGACATTGGTGG CGTAGTCGCCGTGCTCTGGGTTGCGCGGGCGCTCGACCGTTGGGTTATCGGGGACGACGGAGGCGTCCAGTCCGCGCTCG GTGAGGACCTCGCGGGCGATGCGTGCAATGAATTCGGAAAGTTCTGCTGGAGTCACGCCTAAAGACTTTATCAGCACGTA ATGCGGGTTCGTCGCCCCCATCCGTATGCGCTGGGCACGCTGTTCGGCGGGGTGCTTTTGCCTCCGCTTGCACCCAGGGT GCTAGACTACCGATCTGAT GCCTCCGTAGCTCAGGGGATAGAGCACTGGTTTCCGGTACCAGCGGTCGGACGTTCGAAT CGTCTCGGGGGCA CGTTTTATTGCCCGGGTGGGGCGCGTTCACTGCGCGTTCCACCCGGGCCTTTTTATGCCGCGGGGC TACTCCCCACCACGGCGCAGCTGAACCATGTCCACCTGCTTGGCGCCCACCACGCGGGAGAAGCGCTGCGCATCACAGGT CAGCACGATGATCTGGTGCTGCTCGCCCAGTTGGGACAGCACCACGTTCATGTCCCTGCTGCGCTGCGGGTCGCTGTAAC CGAGGCTGTCGTCAATAATGATCGGCACTCCCCCACCCCGGGCCACCAGCGATGCCACCGCGAGCCGGGAAAGCAGGTTG ATCTGCTCCCTCGCACCACCGGACAGGGAGGACACGTCGAGGGCCACGCCGTCGTCGATGCGGCGACTCACCTGCAAGTC CTCGTCGAACTCGAACTGGACCCCCGGACCGTAGATGGTGCGAGCAAGGATATGGAAGGCCTCGGACAACGGGCGGGAGT AGCGACCCCGCAGCTCGGCACGAGCCTCATTCAT