TRNA12

Coordinates:922240-922311

>TRNA12 Anticodon: CTG
TGGCCTATGGTGTAATTGGCAACACTACGGTTTCTGGTACCGTCATTCTAGGTTCGAGTCCTGGTAGGCCAG

>TRNA12 Anticodon: CTG
TGGCCTATGGTGTAATTGGCAACACTACGGTTTCTGGTACCGTCATTCTAGGTTCGAGTCCTGGTAGGCCAG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 921740 - 922811 (Additional range around TRNA12 is :500nt.)

>Corynebacterium urealyticum DSM 7109 AGGTGCTGGGGGACGCCGACGGCCTCCTGCGCTTCCTGCTGACCAAGGACGAGGATCTGGAACTGGAGCCGAAGGCGGCG CGCAAGAACCTCAAGGAGGCAGCGAAGGAGCCACTGGAGGCCGCGATCGAGGAGCTCGAGGCCATCGCGGAGGAGGACTT CCGCACCGAGCCGATCGAACAGGCCCTGTCCACCCGACTGATCGAGCAGATGGAGCTCAAACCGCGCGTTGCTTATGGCG CGCTGCGTGTGGCGATCTGTGGCCAGGCCGTGTCCCCGCCGCTGTTCGAGTCCATGGAGCTGCTGGGCAAGGACTCCACG CTGGTCCGCCTGCGCGCTGGGCTGGAGCAGACTCCCTTCCAGGCTGAACAGCCTGCGAACTAAGCGTTAAAAATAGGCGA CGACCAGCCAATTTGTGTGTAACGATGACTTCTGGCTATAGTAGTCATCGTTGCACAGCGCAGGGCTCCTCAAGAAGGAG ATGCTCGCAGTGTTAACGAT TGGCCTATGGTGTAATTGGCAACACTACGGTTTCTGGTACCGTCATTCTAGGTTCGAGT CCTGGTAGGCCAG CAGCGAAGATTAACTTTTTGGTTTCTCTCGCGTCCTAATGCCCCGTTCGTCTAGCGGCCTAGGACG CCGCCCTCTCACGGCGGTAACACGGGTTCAAATCCCGTACGGGGTACAAATTAACAGCCTCACTGGTTTCCCGGTGGGGC TGTTTTCTTTATTCTGCGGAAATCCCATGCCCGATGTTCGTGCATAGGGGCGAGGACCCAGATGGGGAATAGGTCCCTAG GGTGTGGGGCGATCAAGAGTACGTGTCCGGGGGCGATGGGAACAGTGAAGGCCGCCCCCTTAGTCGTCCTTTGCGCTCCG TACGCGACGTTGGAAGTGTTCGGCCTCAGCCTGAAGCGTTTCGGCGAGCTGCTCTTCACCATCCGCGGCACCTGAGGCTC GGGGCGGGGCAAGGATGAGCTCGGTGGAGTCGTAGCCGGCTGCGAGCTCCCGGGCGCGCGCGAGCTCGGCGTCCAGCTGC AGGCCGAGGAGTAGCACGTTATTGGCCATGAAG