TRNA14

Coordinates:923921-923996

>TRNA14 Anticodon: CTC
GCCCCGTTCGTCTAGCGGCCTAGGACGCCGCCCTCTCACGGCGGTAACACGGGTTCAAATCCCGTACGGGGTACCA

>TRNA14 Anticodon: CTC
GCCCCGTTCGTCTAGCGGCCTAGGACGCCGCCCTCTCACGGCGGTAACACGGGTTCAAATCCCGTACGGGGTACCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 923421 - 924496 (Additional range around TRNA14 is :500nt.)

>Corynebacterium urealyticum DSM 7109 ATTCGCCCGTCACTCCCAGGACCTGATCGCGATTCTGGTCGAGCACCAGCATCACGATCGCGTAGAAGGCCATGAGTGTG GGGATCGCGGTGAAGATGGAGTAGAAGCTCAGCGTCGCGCCTTTATCGGGAAGGCCCCGGTAGAAAAACTCCGCGTAGAG GCGCTTGGCGATCATGCCCCATGCTTTCGGGCCGGGGAAACGATGCGCGCTGGCAACCTCGACTGAGTACACTTCCGGAG AAATCGCCTGCCGGCCCGCGCCGCCACCGGCCGGCATCACGAGCGGGTCGGGGCTGTCATTCTCGGAACGGGTCATTGGC ATCCTCGGCACATCGGTGAAACTGGTGCCTTCATGCTAACGCGAAAACTTCCTAAAACCCGGCATTGACCAGCGGATTAG GAGAGTTGCAACTATTGCCTGTAGGCTTTGTTCTCGATCATAGAGCTGGTTGCTACTTCACCGGCCCGCCGGTAAAGAGC TAGCTTTGTGCGTCCTATGC GCCCCGTTCGTCTAGCGGCCTAGGACGCCGCCCTCTCACGGCGGTAACACGGGTTCAAA TCCCGTACGGGGTACCA AGAAAAACCTCCCACCACAGTCACGTGGCCGGAGGTTTTTGCATTTCTGTGCTTTAGCTCCG TGATCCCCGGAGGACACTGCTTCTAAAACTTCTGCCCCGCTGCATAGCAGCGGGGCAGAAGGGTTTATGGGGGTGGGACT TTAAGCCTGTGTCTGGTCAACCTTCTTGAGGCGGGAGTAGACCAAGGCGGAGAGTCCGACGAAGGCGATGATGCCGATCC ACTGCGCTGGGCCTGCGAAGCTCTCGCCGACGACGGCCAGGGCATCGCCGTTGGAGGTTGCCGCGATGATGCCGGCGTTG ATGACTCCGAAGAGGGACTCGCCCACGATCAGGCCGGTGGCCATGAGGACACCCATGCGCTTGCTGCGCTGCGGATTAGC CTGCTTGTCAGCCCACTTGTTGTAGACGTACCCCAGGGCTGCGCCGATAGGGATGATCAGCGTGAGAGATGCCGGAAGGT ACATTCCCATGCCAACCGCGAGTGGTGGCAGGGAGTA