TRNA15

Coordinates:1097568-1097643

>TRNA15 Anticodon: GCC
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA

>TRNA15 Anticodon: GCC
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097068 - 1098143 (Additional range around TRNA15 is :500nt.)

>Corynebacterium urealyticum DSM 7109 AAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCACTCTTATTTTAGAGGACCGCGCGATTAGCTCAGCGGTAGA GCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCACGGTGAGTTCACCTTAACGGTGAGTTCGCA C GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA G GTATTCTCTACCCTGCGTGGAGGATCACCACATCAGGCGGGTTTCACGCCACGGTGGAATGGCTGAGTGGCTTAGGCAAC GGTCTGCAAAACCGTCTACACGGGTTCGATTCCCGTTTCCACCTCTCAGTTCGCCACCACGGCTGAACTTGAAAGCTAGC GCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCACGGTGAGTTC ACCTTAACGGTGAGTTCGCAC GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGA GTCTCGTCATCCGCTCCA TATAAGAAGAGGCAGCAGTATTCACACTGTTGCCTCTTTTCTCATATCCCCAAGATATTCT CGAAGACACCATGAGCCTCTCTGCCACTTCCCCAGCGCCCTTTTCCGCGTCACCGGCCCCGGACGAGCCTCGGCGCGGCA GTGCAAGCATGAGCCGCTTCGATGAGCGCTTCCCGTGGATAAGTTGGGCGCTGTGGCCTCTGGCGATCCTCACTGCCCTG CATAAGATTTGGGCTTCCTACGAGAGTGGCACAACGGACGATTTCACCACAGTCTGGGAGGCCCTCAACCGCTTCTGGTC GGGTGTTCCCGTGTATTCCGAGGACTACACCACCACAGACCCGCACTATCTCTACCTTCCGGGCGGGACGATGCTCCTGA GCCCACTGTCGGCCCTCGGCAGTTTTGAAGCAGCGCGGGCGCTATATGTCTTCGGCAACGCCATCGCGATCGTGATTGCC CTGGGGCTTTTGAGCCACATCATCTACACCGCCCGTGGC