TRNA16

Coordinates:1097675-1097746

>TRNA16 Anticodon: GAC
GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA

>TRNA16 Anticodon: GAC
GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097175 - 1098246 (Additional range around TRNA16 is :500nt.)

>Corynebacterium urealyticum DSM 7109 ATCGTTTAGTGCTGCAGCACAGCTTGCAACCGACGAATCGTAGATTCTCAGTGAAAGCTTGTGCAATGCGGATGTAGCGC AGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCACTCTTATTTTAGAGGAC C GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA CGGTG AGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGT TCGAGTCTCGTCATCCGCTCCAGGTATTCTCTACCCTGCGTGGAGGATCACCACATCAGGCGGGTTTCACGCCACGGTGG AATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGGGTTCGATTCCCGTTTCCACCTCTCAGTTCGCCAC CACGGCTGAACTTGAAAGCTA GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGAT CCCAGTATCGCGCA CGGTGAGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAGCGCAGTTGGTAGCGCATCACCTTG CCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCATATAAGAAGAGGCAGCAGTATTCACACTGTTGCCTCTT TTCTCATATCCCCAAGATATTCTCGAAGACACCATGAGCCTCTCTGCCACTTCCCCAGCGCCCTTTTCCGCGTCACCGGC CCCGGACGAGCCTCGGCGCGGCAGTGCAAGCATGAGCCGCTTCGATGAGCGCTTCCCGTGGATAAGTTGGGCGCTGTGGC CTCTGGCGATCCTCACTGCCCTGCATAAGATTTGGGCTTCCTACGAGAGTGGCACAACGGACGATTTCACCACAGTCTGG GAGGCCCTCAACCGCTTCTGGTCGGGTGTTCCCGTGTATTCCGAGGACTACACCACCACAGACCCGCACTATCTCTACCT TCCGGGCGGGACGATGCTCCTGAGCCCACTGTCGG