TRNA17

Coordinates:1097781-1097852

>TRNA17 Anticodon: GCA
GGTGGAATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGGGTTCGATTCCCGTTTCCACCT

>TRNA17 Anticodon: GCA
GGTGGAATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGGGTTCGATTCCCGTTTCCACCT


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097281 - 1098352 (Additional range around TRNA17 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCGCATCCAAAGCAACAACGGCAGGCAAATAACAACGAAGTGACTTTAAGCCAACGCGATTTTCAGCCCTACACCTGGCG ATTTGTTGCTTCGCACACCATTGACTATCGTTTAGTGCTGCAGCACAGCTTGCAACCGACGAATCGTAGATTCTCAGTGA AAGCTTGTGCAATGCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCA TCCGCTCCACTCTTATTTTAGAGGACCGCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGT TCGATCCCAGTATCGCGCACGGTGAGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAGCGCAGTTGGTAGCGCATCAC CTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCAGGTATTCTCTACCCTGCGTGGAGGATCACCACAT CAGGCGGGTTTCACGCCAC GGTGGAATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGGGTTCGATTC CCGTTTCCACCT CTCAGTTCGCCACCACGGCTGAACTTGAAAGCTAGCGCGATTAGCTCAGCGGTAGAGCACTTCCCCG ACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCACGGTGAGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAG CGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCATATAAGAAGAGGCA GCAGTATTCACACTGTTGCCTCTTTTCTCATATCCCCAAGATATTCTCGAAGACACCATGAGCCTCTCTGCCACTTCCCC AGCGCCCTTTTCCGCGTCACCGGCCCCGGACGAGCCTCGGCGCGGCAGTGCAAGCATGAGCCGCTTCGATGAGCGCTTCC CGTGGATAAGTTGGGCGCTGTGGCCTCTGGCGATCCTCACTGCCCTGCATAAGATTTGGGCTTCCTACGAGAGTGGCACA ACGGACGATTTCACCACAGTCTGGGAGGCCCTC