TRNA19

Coordinates:1098013-1098084

>TRNA19 Anticodon: GAC
GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA

>TRNA19 Anticodon: GAC
GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097513 - 1098584 (Additional range around TRNA19 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGGCCCCTTAACAACCGTGGTCCTAACTGGGATTGAACCAGTGACCCCTTCGGTGTGAACGAAGTGCTCTCCCACTGAGC TATAGGACCTAGCAGCACATAATCTAGCCTAGCTCCATAATTTTTTCCAAAACCTGCAGGCCACAACCGCATTCAGCGCG ATACTTACCAGCCCGCGGCGCCCCACCGCGACCACTTGGCACCCCACAGTGCGCCAACGGCGTCTAAAACGTCCGCATCC AAAGCAACAACGGCAGGCAAATAACAACGAAGTGACTTTAAGCCAACGCGATTTTCAGCCCTACACCTGGCGATTTGTTG CTTCGCACACCATTGACTATCGTTTAGTGCTGCAGCACAGCTTGCAACCGACGAATCGTAGATTCTCAGTGAAAGCTTGT GCAATGCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCC ACTCTTATTTTAGAGGACC GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCC CAGTATCGCGCA CGGTGAGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCC AAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCAGGTATTCTCTACCCTGCGTGGAGGATCACCACATCAGGCG GGTTTCACGCCACGGTGGAATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGGGTTCGATTCCCGTTTC CACCTCTCAGTTCGCCACCACGGCTGAACTTGAAAGCTA GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGA AGGGGTCACTGGTTCGATCCCAGTATCGCGCA CGGTGAGTTCACCTTAACGGTGAGTTCGCACGCGGATGTAGCGCAGT TGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCATATAAGAAGAGGCAGCAGTA TTCACACTGTTGCCTCTTTTCTCATATCCCCAAGA