TRNA2

Coordinates:16737-16812

>TRNA2 Anticodon: TGC
GGGGCATTAGCTCAATTGGTAGAGCATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCACGA

>TRNA2 Anticodon: TGC
GGGGCATTAGCTCAATTGGTAGAGCATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCACGA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 16237 - 17312 (Additional range around TRNA2 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GTGGCTCGTGCTGGCGGTAGCCGGCGTGTGGGGCCGCATGAACTCCCTGCTGGCGGACATCGCGGGCTTCGGCGGGATCT CCGGCTGGGGCGTGCTGGGCGCGGTGGCGCTCGTCGGCATCCTGGAGTTTTTCGTCGTCTGGGGCATCGTGCCGCTGGCT GCGCTGGTGTACAACGCGGCGGCGGATGTCCTCGGCGGGCTGAAGGTGCGCGTCGCGGATCCGGAGGACGCGGCGACGGA GATGCCGGACAACGTGGCCGCGCCGGAGACGTCGACAACGTCGGAAGAGGCCTAGCTCAAGGCCCTGCATTCTGGCGGAA GAAAACTTAATAAAACAGGGGCTGACCAGGCGATTTGGTTTATATCGCATCGCATGGATACACTAGTCCCTGTTCGAAGG GCCTATAGCTCAGGCGGTTAGAGCGCATCGCTGATAACGATGAGGTCGGTGGTTCGAGTCCACCTAGGCCCACCATTCGA ACACACTTCGAATGAAGTTC GGGGCATTAGCTCAATTGGTAGAGCATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGAT TCTCCTATGCTCCACGA AACAGCAGGTCAGAGGGTGTTTTCACCCCCTGGCCTGTTTTCGTTTTTGGTGTTTGTCCTGC TCAAGGACAGATTCCTTATGGCACGACACCCCCGCCCGTCGTGACTGTCCGACGGCGGACAGGGGTAGTTATGGCACGGT TATGGCACGGAATTCTTGGGGATCCACCCGGAAACTGCCCAGCGGACGGATCCAGGCTCGATACCTTGGACCAGACGGAA AGACCTACAAGGCACCCAACACGTTCCCAGACGAGCTCTCTGCTCTGGCATGGCTTGGGGATGTGCGTAAGACCATCGAT CTTGGCTCCTGGGAGCCGCCGCAACTGAAGAAGATGAAGGTCGCTGTTCCCACGGTTGGCGAAGCGGTAGAACACTGGTT GTCAATGATGAAGGCCGGCGTGCGTGACTCCACGTACGCCACGTACTCAGCGATTGTCACCAACCGCGTGTTGAACGATG AAGCCCTATGCGCGGTCCCCGTGGACCGGCTCACGGT