TRNA20

Coordinates:1098103-1098178

>TRNA20 Anticodon: GCC
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA

>TRNA20 Anticodon: GCC
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097603 - 1098678 (Additional range around TRNA20 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCCGGCGACACGCCGGGCAGACACACTTTTTGCTACTTAACCCCCTCTACACCAGGGGACATTCGATACAAAAAAGGAGC CGGTCACTGACGACCGGCCCCTTAACAACCGTGGTCCTAACTGGGATTGAACCAGTGACCCCTTCGGTGTGAACGAAGTG CTCTCCCACTGAGCTATAGGACCTAGCAGCACATAATCTAGCCTAGCTCCATAATTTTTTCCAAAACCTGCAGGCCACAA CCGCATTCAGCGCGATACTTACCAGCCCGCGGCGCCCCACCGCGACCACTTGGCACCCCACAGTGCGCCAACGGCGTCTA AAACGTCCGCATCCAAAGCAACAACGGCAGGCAAATAACAACGAAGTGACTTTAAGCCAACGCGATTTTCAGCCCTACAC CTGGCGATTTGTTGCTTCGCACACCATTGACTATCGTTTAGTGCTGCAGCACAGCTTGCAACCGACGAATCGTAGATTCT CAGTGAAAGCTTGTGCAAT GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGT CTCGTCATCCGCTCCA CTCTTATTTTAGAGGACCGCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGG TCACTGGTTCGATCCCAGTATCGCGCACGGTGAGTTCACCTTAACGGTGAGTTCGCAC GCGGATGTAGCGCAGTTGGTA GCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGTCTCGTCATCCGCTCCA GGTATTCTCTACCCTGCGTGGAGG ATCACCACATCAGGCGGGTTTCACGCCACGGTGGAATGGCTGAGTGGCTTAGGCAACGGTCTGCAAAACCGTCTACACGG GTTCGATTCCCGTTTCCACCTCTCAGTTCGCCACCACGGCTGAACTTGAAAGCTAGCGCGATTAGCTCAGCGGTAGAGCA CTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCACGGTGAGTTCACCTTAACGGTGAGTTCGCACGC GGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGT