TRNA21

Coordinates:1098495-1098566

>TRNA21 Anticodon: CAC
GGTCCTATAGCTCAGTGGGAGAGCACTTCGTTCACACCGAAGGGGTCACTGGTTCAATCCCAGTTAGGACCA

>TRNA21 Anticodon: CAC
GGTCCTATAGCTCAGTGGGAGAGCACTTCGTTCACACCGAAGGGGTCACTGGTTCAATCCCAGTTAGGACCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1097995 - 1099066 (Additional range around TRNA21 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GTTAAGGTGAACTCACCGTGCGCGATACTGGGATCGAACCAGTGACCCCTTCCGTGTCGGGGAAGTGCTCTACCGCTGAG CTAATCGCGCGGTCCTCTAAAATAAGAGTGGAGCGGATGACGAGACTCGAACTCGCGACCCTCACCTTGGCAAGGTGATG CGCTACCAACTGCGCTACATCCGCATTGCACAAGCTTTCACTGAGAATCTACGATTCGTCGGTTGCAAGCTGTGCTGCAG CACTAAACGATAGTCAATGGTGTGCGAAGCAACAAATCGCCAGGTGTAGGGCTGAAAATCGCGTTGGCTTAAAGTCACTT CGTTGTTATTTGCCTGCCGTTGTTGCTTTGGATGCGGACGTTTTAGACGCCGTTGGCGCACTGTGGGGTGCCAAGTGGTC GCGGTGGGGCGCCGCGGGCTGGTAAGTATCGCGCTGAATGCGGTTGTGGCCTGCAGGTTTTGGAAAAAATTATGGAGCTA GGCTAGATTATGTGCTGCTA GGTCCTATAGCTCAGTGGGAGAGCACTTCGTTCACACCGAAGGGGTCACTGGTTCAATC CCAGTTAGGACCA CGGTTGTTAAGGGGCCGGTCGTCAGTGACCGGCTCCTTTTTTGTATCGAATGTCCCCTGGTGTAGA GGGGGTTAAGTAGCAAAAAGTGTGTCTGCCCGGCGTGTCGCCGGGTGGGCCCTTTTTATCTCATGGGCCCTTTCCGGATT CCTATGTTGTGTTGGTATTCGGTTGGGATAGCGTTGTCGTAGAAGGCTGGTCGTCCTGTTTCGTGGTCGGCTTTGTTGTG GTCTTCTGGGACAAGATCGTTGACTTTGGCGAGTTGATCTTGTCCGTAATTGCACTGCCTGGCGATCTTTAGCAGGTCGT CAGGCAGCTGCGTTTTCGAGTGCAGGTACCACTCGAGCATTTTGCGTTGGCGTTCCCCGGATCTGCCGCGGTGGGCATCG GCGATGCGTTTGAGTTGGGCGTTGATGCCGCCTTCCAGACTGTTTGTTGTTGATGCCCAGCGCTGTGGTTCGAGTGCTTC TGGTGGGGGCTGCAGGTAGGTAAACAGCCATCC