TRNA23

Coordinates:1270334-1270410

>TRNA23 Anticodon: GGG
CGGGCTGTGGCGCAGTTTGGTAGCGCACTACACTGGGGGTGTAGGGGTCGCAGGTTCAAATCCTGTCAGTCCGACCA

>TRNA23 Anticodon: GGG
CGGGCTGTGGCGCAGTTTGGTAGCGCACTACACTGGGGGTGTAGGGGTCGCAGGTTCAAATCCTGTCAGTCCGACCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1269834 - 1270910 (Additional range around TRNA23 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGGTCCTGCGACACGCAGTTCCAGGACCTCGGCGGCAAGGTCGAGTTCTGCGGCCGCATCACCACGGTGTCCTGCTTCCA GGACAATGCGCTGCTGAAGTCCATCCTCAGCGAGCCGAACCCGGGCGGCGTGCTGGTCATCGATGGCCAGGAGTCCCTGC ACACCGCACTGGTGGGCGACATCATCGCCGGCCTGGGCCAGAAGAACGGTTGGGCGGGCGTGATCGTGAACGCCGCGATC CGCGACAGCAAGGCCATCGGCGACATGGACTTCGGCTGCAAGGCGCTGGGCACCAACCCGCGCAAATCCACGAAGACGGG TGCTGGCGAGAAGGATGTTGTGCTGCGCTTCGGTGGCGTGGAGTTCAACCCGGGCGAGTACGTCTATGCGGACTCGGACG GCATCATCGTCACGGAATCCCCGGTTGACCCGCAGTAATGCCCACTGGCGGGGCTGATTAGTACGCGCCCTGAGCCATGC TGTACTGTTACAGGGCGTAA CGGGCTGTGGCGCAGTTTGGTAGCGCACTACACTGGGGGTGTAGGGGTCGCAGGTTCAA ATCCTGTCAGTCCGACCA CGTGAAAGAAGCCCTGGCCGCAAGGCCAGGGCTTCAGTCGTTTCCGCAGGTCAGGGGCACT GTGGCCTATCCTTCTTCGCCCTTTTCACCCGTTGTCTTATCTTCCTCGGACTTCTTCTTGTCCAGCTCACCCATCTCCTT AGCCGCGGCCATGATGTCGGCCAGGGCGTTGATCACACCGTTGAGCACGTCCCGGTCACTGGAGAGCAAGGTATCGCGCT TCTTACGCTCCGCGATGCCGTCGAAGATCGCCTGCGTCGCCGCGCCCTGGAACTTCTTGGAGCGTTTGAGCTGTTCCTTG GAGTTCGTCCGACCCAGTTTCACCGCCTCGGGCTGCTCGGAGAGTGTGCCCCAGGCCGCAACGATCATCTGCGAGGTTTC ATCGGAGTTCACGTCTACACCGGCCATCGAGAAGATGTCGTTGACCTTGTCCACCGCGTCGTAGAATGCGGCGCGCATAG GGGTGCCTTCCCCACCCACGGTGACGTCGAAGGTAGGC