TRNA24

Coordinates:1357213-1357286

>TRNA24 Anticodon: CAA
GCCCCCGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAGTCTCACCGGGGGCA

>TRNA24 Anticodon: CAA
GCCCCCGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAGTCTCACCGGGGGCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1356713 - 1357786 (Additional range around TRNA24 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCGGTGCAGATGAGGGTGTTCATGCCCGCGTCATGGCCCTGGGTGGCTAGCGAGGCGATGATGTCGTCCGCCTCGTAGCT TTCCTTATCCAAGGTGGTGATGCCGAGGGTCTTCAGCGTCTCGCGGATCAGCTCGATCTGGCCCTTGAACTCCGGCGGGG TGGATGGGCGCTGCGCCTTGTACTCGGGGAACTCCGCTTCGCGGAAGGTCGGGCCCGAAAGGTCGAAGGCGGCGGCGATA TGGGTGGGCTTTTCCTGTTCCACCAGCCCCAGGAACATCCCCAGGAATCCGTAGACGGCGTTGGTGTGCTGCCCGCCGGT CGTCGAGAAGTTCGCCGCCGGGAGGGCGTAGAACGCCCGGAAGGCAAGGGAATGCCCGTCGAGGAGGAGCAGGGTTTCTT CAGATTTACCACCGGTTGTCATGCCCGCCATCCTACTGAACCGCACCCCGCCCGCTGTTTTGTGCCCACCTGGGCGCTGC CGTATGCTTTGACCTATTGC GCCCCCGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGA GTCTCACCGGGGGCA CGTTTTAACCCCGCTGCGACCAGCATGAGCGCCAGGTCACAGCGGGGTTCTTCTTTTTCCGCCA CTTCCGCCGGGCAAGGCCAGGGTGGTTAGCGGAGCATCTTCAACATCAGATATCCGACACCTGCACTGACCCCGATGCAG CCGCCGACCGAAAGGTCCGCCCAGACGCCAACACCTAGGCCGACGAGTCCCATCGCAACCCCAACCAGTGGCGCGGCGAT GAGGAGGGTGCGAGTAGTGGAGCACACTCCCACCAAGCCAGCGGCGGGTGCCACGAGCAGAGCGATCGAAAGAATCGTCC CGACAGCAGGAATGAGCGCCACCAGGGTGGCCACAATAAGCGCACTGATGATCCCTTGCGCAAACCTTCGATTGTGGGAC ACCCCGAATGCTTCAGGGTCGAAGGCGAAGAACACCAGCTTCCGCCAGCCACCCCACAGGATGAACAGAGTGACTGCGAG CAGCCCGAGGGAAATTCCGATGTCCACCCAATCAA