TRNA25

Coordinates:1539568-1539643

>TRNA25 Anticodon: TAC
GCGCTCTTAGCTCAGCTGGAAGAGCAACTGGTTTACACCCAGTAGGTCGGCGGTTCGAACCCGTCAGAGCGCACCG

>TRNA25 Anticodon: TAC
GCGCTCTTAGCTCAGCTGGAAGAGCAACTGGTTTACACCCAGTAGGTCGGCGGTTCGAACCCGTCAGAGCGCACCG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1539068 - 1540143 (Additional range around TRNA25 is :500nt.)

>Corynebacterium urealyticum DSM 7109 AGTGGGTAACACTCCCAGCGACCCAGTCCGCGACGAGAAAGGCTCGGAGGGACTGAATTGCGCAGAGCTGCTGGAGGTCT CCAGCGGCACGATCATTCAGGAGCTCGGCTGGGATGAGGACTGCGATTCCTCGATCAGCGAGGCCCTCGAGGACGCAATC GGCGAGGAATTGCTGGGCCCGGATACCGACGAGCTCGTTGACGTGGTGCTGTTGTGGTGGCGCGAGGAGGACGGCGACCT GGTCGACGGGCTGATGGACGCCAACCGTTCCCTGAGTGAGGACGGTCGCGTCTGGGTGCTGACCCCGGCGCCAGGCCTGA AGAACTCTATTCAGCCGGGTGAGGTCGCGGAGTCCGCGCAGCTGGGTGGCATGGTTCAGACCGGTTCGGAGCGTCTGGGG GATTGGCAGGCTGCGTGCCTGGTCGCGCGCGGCGCGAAGCGTTAGCCCTGGGCCTATTTGCCCCGCCGGGATGGCTGGGC TAATCTCTCTAGCTGTTGC GCGCTCTTAGCTCAGCTGGAAGAGCAACTGGTTTACACCCAGTAGGTCGGCGGTTCGAAC CCGTCAGAGCGCACCG AGTCAAACCCTAGCGAACAGTAGGTTCGTGAGGGTTTCTTTTTATTTCACGCACATGTGACGC TGTTGCGTGGGGTTAGTGCCTGGAAAGCCGCAGCACCGTGGGGGTCGTCGGGACATCCTCGGGTGAGCCTGTGCATTGGC TGCAGTGGCGCGGCGTCCGTGGGTTCTTGAGCGTCGGGGAGGGCGGGCTAGAGTAGGTTCTCGTAAAGGGAGTCCTTGGA TAGCGGGTTCCTGACAGCACCAGGCAGGCCCGACGGGAGGAATGAACGATGGCGGTCGATCCACAGCGCGGCCAGGAGCA GAAGCGCGGCTTTCGGGCTTTTTTGACGCCGGGCTGGATCCTCTCGGCTGTTTTCGTGCTGCTGTTCACCTATTTCGCCT TCAACACCCTGGCGCCCTGGCAGCTGGGGAAGAACACCAAGCGCACGGAGTTCAACGATCGGCTCAAGGCCGCGATGGAG CAGGCCCCCGTGCCCGTCTCGGAGGTGCTCCCGGCCG