TRNA26

Coordinates:1550087-1550161

>TRNA26 Anticodon: GTT
TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATCCAGCTGGGGGAGCAA

>TRNA26 Anticodon: GTT
TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATCCAGCTGGGGGAGCAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1549587 - 1550661 (Additional range around TRNA26 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TGATCCACCAGCACCATCGGAATCGGTGGTGCATGGTTTGCCTGGTTACGCCATGGTGTGCGGCGAAGGTGGTTAGAGAT TGGGTGCCGGTGGCCCATTGGATGAACAAAGCCATGGTGGCGGTGTTTTTGTTGTGGGTTTGGGTGTTGCGGGTAAAGGA GTGTCCGCAGTGGGTGCAGCGCCAACGGGTGGTTGATTTGCTGGTGGTGCCGTTTTTCTTTGTGTTGTTGCCGCATAGTG GGCAGCTGGGGCGGTTGGTGGTCATCCTTTAATCCAACCGGTGTGCGGTTAGCACAAATGTGGCCGGAGGTGCGGGATGG TGTGGGTAATAGCTTTCGGGGAGCTATTCTTTGGTGATTTGTGGTGTGTGGTCTGGGGTTATGGTGGCATGCGGACACAC TTTTCTTTACTTAACCGGAACCTGTTCCCAGTACCGGGCTGGGGGTGGTGACAGGATTTGGTGGACGGGGTAAGCCTTAG TAAGCTTCCTCGTGAGCAT TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATC CAGCTGGGGGAGCAA AAGGCCCAGGCTGCACAGCCTGGGCCATATTTCTTTCCACAGCCGGGGCGCATGCTGGGAGGGG TACGCGCCACCGCGCTAACCGGAGCTAGCGGGAACTATCGTCTTCGCTGTCTGCGTCTTCCTTGGAGTGTTCCTCCGTGT CCGAATCAGAATTAGATCCGGAGACACGTTCAGTCCAGTAGTCCTCCATCGCTCGGGCATCGTTGGCGATCTCGGCCTCT GCCTCGGCCCGGGCCTCAGCGTCAGCGACGGCCTGCTCGAACTCTTCCCGCTCGATCTGTGCGCCGGCCTTCTCTTCCAG CTTGTGGACGATGTAGTCCTCCGAGGCATTGTCGGTGTACCAGGTGTGGAAGGACTCGTCCTCCACGTCCACGGCTTCAG CAGCACCCTGGCCCTCCGGCACCTGGGTGGCGCCGAAGATGAAGTGGCCATCGTGCTCGTCCAGGCCCCGGCGCACGCCC CGGTCGATCGCTTCCACGGCGAAACGGCGACGCAGC