TRNA27

Coordinates:1551686-1551760

>TRNA27 Anticodon: GTT
TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATCCAGCTGGGGGAGCAA

>TRNA27 Anticodon: GTT
TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATCCAGCTGGGGGAGCAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1551186 - 1552260 (Additional range around TRNA27 is :500nt.)

>Corynebacterium urealyticum DSM 7109 ATGGTCGCCGAGGAGGAGTACTGCATCGACGTGCTCACTCAGATCGCGGCACTGCAGTCCGCACTGAAGGGGGTGGGGCT GGTGCTGCTGGAGGAGCACATGGCGCACTGCGTGGTACAAGCCGCCCGAACCTCGGATCAGGCGGTGGAGGAGAAGCTGG AGGAAGTGTCGCAGGCGATCGCGCGCTTCACTCGCTAACTGCCTAAGGGCGGGGTGAAGGATACGAAAACCCCGGCGGGG CTGGTGCTCTTTCCAAGCTGCCGGCCCGCCGGGGAGCCGCCCCGCGTTGGGCGGCGAATGATTCTTGTGGGACCAGCGGG GCTCGAACCCGCGACCAGCGAATTATGAGTTCGCGGCTCTAACCGACTGAGCTATGGTCCCGCCACCAGGTCATTGAACC ACACCGCAGCCTTAAAGCCGATATTTACGCTGTGACCTGCTGATTTGGTGCTTATGGGCTTGCTGGGTAGAGTGTCTATT CGTTGCCAAGATGGCATAT TCCCCCATAGCTCAATGGCAGAGCACTCGACTGTTAATCGAGTGGTTGCTGGTTCGAATC CAGCTGGGGGAGCAA CACCACAACCCAGGGTCCGCAAGCCCTGGGTTTTCTTCTTTTCTACCGCCCTGTGAACCTGTGG GTTAAGTAAAGAAAAGTGTGTCTTTTCCGGGCGTGTTGCGGTTATTTGATCCAGCCTTTTTGGATGCCGAGGTTGTGTTG GTAGCTGGTGTCGATGGCGGTGTCGTATTCTGCTGGTGCACCGATGTCATTGGTAGTGGCTGTGGTGTTGTGGGCGATCA GGTCTGTTGCTGTGGAAAGTGCGTCTTGGCCCCATCGTTGGTCCCTGGCGATCTTGACCGGATCGTCAGGGACTTCTGTA TGTAGATACAGCCACCAATCCATCACTGTGCGTTGATGCGGTAGTGATAGTCCGCGGTGTCTGCGGGCTAGTTCTTTTAT GGGGGCGTTGATGCCACCTTCGAGGCTGTTTGTTGTTGCTGCAAGGTTGTCGGGGTCGATGGTTGTTGGTGGGGGTTGCA GGTAGGTAAACAGCAGGTCTCTGCGGTGCAGAGATA