TRNA28

Coordinates:1551879-1551955

>TRNA28 Anticodon: CAT
GGGACCATAGCTCAGTCGGTTAGAGCCGCGAACTCATAATTCGCTGGTCGCGGGTTCGAGCCCCGCTGGTCCCACAA

>TRNA28 Anticodon: CAT
GGGACCATAGCTCAGTCGGTTAGAGCCGCGAACTCATAATTCGCTGGTCGCGGGTTCGAGCCCCGCTGGTCCCACAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1551379 - 1552455 (Additional range around TRNA28 is :500nt.)

>Corynebacterium urealyticum DSM 7109 ACATACAGAAGTCCCTGACGATCCGGTCAAGATCGCCAGGGACCAACGATGGGGCCAAGACGCACTTTCCACAGCAACAG ACCTGATCGCCCACAACACCACAGCCACTACCAATGACATCGGTGCACCAGCAGAATACGACACCGCCATCGACACCAGC TACCAACACAACCTCGGCATCCAAAAAGGCTGGATCAAATAACCGCAACACGCCCGGAAAAGACACACTTTTCTTTACTT AACCCACAGGTTCACAGGGCGGTAGAAAAGAAGAAAACCCAGGGCTTGCGGACCCTGGGTTGTGGTGTTGCTCCCCCAGC TGGATTCGAACCAGCAACCACTCGATTAACAGTCGAGTGCTCTGCCATTGAGCTATGGGGGAATATGCCATCTTGGCAAC GAATAGACACTCTACCCAGCAAGCCCATAAGCACCAAATCAGCAGGTCACAGCGTAAATATCGGCTTTAAGGCTGCGGTG TGGTTCAATGACCTGGTGGC GGGACCATAGCTCAGTCGGTTAGAGCCGCGAACTCATAATTCGCTGGTCGCGGGTTCGA GCCCCGCTGGTCCCACAA GAATCATTCGCCGCCCAACGCGGGGCGGCTCCCCGGCGGGCCGGCAGCTTGGAAAGAGCAC CAGCCCCGCCGGGGTTTTCGTATCCTTCACCCCGCCCTTAGGCAGTTAGCGAGTGAAGCGCGCGATCGCCTGCGACACTT CCTCCAGCTTCTCCTCCACCGCCTGATCCGAGGTTCGGGCGGCTTGTACCACGCAGTGCGCCATGTGCTCCTCCAGCAGC ACCAGCCCCACCCCCTTCAGTGCGGACTGCAGTGCCGCGATCTGAGTGAGCACGTCGATGCAGTACTCCTCCTCGGCGAC CATCCGCTGCACACCGCGCACCTGGCCTTCGATGCGCTTCAGCCGCGCGATCAGCTTGGCCCGGTCGCCGTGGCCGCTGA GCGGCTTCTCGCTGTGATCAACCTTGCCATTGGCCGCGGGATCGCCGTGCTGTGGCGCGTGGCAGTCGCTCTTGGTTGCT GGCTTCGCATTATCCATGGTGACTACTTCTCCTCGACC