TRNA3

Coordinates:69332-69419

>TRNA3 Anticodon: CAG
GGGCGAGTGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGTCCTTTACGGACGTGGGGGTTCAAGTCCCCCTTC
GCCCACAA

>TRNA3 Anticodon: CAG
GGGCGAGTGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGTCCTTTACGGACGTGGGGGTTCAAGTCCCCCTTC
GCCCACAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 68832 - 69919 (Additional range around TRNA3 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TTGGGGCAAGCCGGTTGCCCTCGCTATCCACCATCACGGAGTCCTCGGCCTGCTGCTTCAGCATCTCGTCGATCTCGGTC GGGACAACTTCGCCACCGAATACCCGCGCGAAGCTGTTATCCAGGCCCCGCTGTAGTGCGCTATCCAGTTTGCGAAATTT TCCGAAAAGATCCATCGATATTTTCCTTCCTTGGACGTCTAGGCCGTCTAACCAGAAAGGCCGCGATCGGTGAATCGCTT TAGCCTCGTGGTGCTTCGCTCGTGGTGAAGGGCAGGTCGCGCTGTGCAACGCGCCGCCGCAACGGGGTAGACGTACACAT GTTGAACGGCCATTATACGGGGATAACTAGGTGGGGCCGGGTTAGTGCAGGTCACGCGGTAATTTTGTTGTGGTCTATAG CTCGTGATACGCTTCTTCCTGTTGCAAACGCACCCGGCGTTAAGCCCACGCTTTGCACCCATGCGTACCAAGCCTCATCG TTTGGAGCGGATGAAGCCAC GGGCGAGTGGCGGAATTGGCAGACGCGCTGGCTTCAGGTGCCAGTGTCCTTTACGGACG TGGGGGTTCAAGTCCCCCTTCGCCCACAA TAGCGGCCCCAGGTCGCAGGAACCGGTGGTTCACCTTCAACAGGTGGCCA CCGGTTTTTCTTTGTGCCCGGCTGAGCCCGCCGGTGGGGGCTCCTAAGATGTGGTGCATGAGTTCTGACCCACGCACCGC GAGCACCGACCCGCTCCTTCAAGCCCCGCACGGTTTCCGCCTCCGCCGGGTGAGCCCAGCCGACATCCCCCAGATCCTGG AGCTCATCCAGGACCTCGCGGAGTATGAAAAGGAACCGGACGCCGTCCACGCCACCGAGGAAGCCCTCCACGAGCACCTC TTCGGCGAGAACCCGGCTGTGTTCGGGCACGTCGTCGAGGTGCTCGACGGAGATATCGAGGACCGGGACATCAAGGACGG GGGCGTCGCGGACAGCAGCGGCGCCGAGAACGGAGACGTCGCGCCGGGCGAGCGCCCCCGCCTGGCCGGCATGGCGCTGT GGTTCCTCAACTTCTCCACCTGGGAGTGCACCCACGGCATCTACCTGGA