TRNA30

Coordinates:1634123-1634197

>TRNA30 Anticodon: TCC
GGGAACGTCGTATAGTGGCTAATACCTCAGCCTTCCAAGCTGAAGACGCGGGTTCGATTCCCGTCGTTCCCTCCA

>TRNA30 Anticodon: TCC
GGGAACGTCGTATAGTGGCTAATACCTCAGCCTTCCAAGCTGAAGACGCGGGTTCGATTCCCGTCGTTCCCTCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1633623 - 1634697 (Additional range around TRNA30 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TGCGGTGCACATACCTACGACGCGAACGACGACTACCCGGCTTTCTGCATCGAGGCAGCCCGCCGGGTCGTCGCCGACGA GGGCTCCCTGGGCATCGTCCTGGGTGGTTCCGGCAACGGCGAGCAGATCGCGGCGAACAAGGTACCGGGCGCGCGCTGCG CATTGGCCTGGTCCGTGGAGACCGCGAAGCTCGCTCGCGAGCACAACAACGCCCAGCTCATCGGCCTGGGCGGTCGCATG CACTCCGAGGAGGAGGCGCTGGCTATCGTCGACGCCTTCATCGCGCAGGAGTGGAGCGAGGCGGAGCGCCACCAGCGTCG CATCGACATCCTCGCTGAGTACGAGAAGACCGGCGAGGCTCCGGCCCTCCCGGAGGCCTAAAATCTTGGCTCACCCCGGT GGTGTCGGTTGGGTAGTTGACCGCGCCATCGTGTAGGGTGTCTATCCACAGCAAGCTTCGTGCTCACGCCGGGCCGGCAT GATGCGAAGATTGCTTGCT GGGAACGTCGTATAGTGGCTAATACCTCAGCCTTCCAAGCTGAAGACGCGGGTTCGATTC CCGTCGTTCCCTCCA CTCTGACCAGCGGTTATAGCGGGGGATTCCAGGCTGCACACAGCGGTTTGGACTTTCCCCAGGG CTAACGTATGGTTAGAGCGCACGCAACGCGAGCTTAGGTTCGCGAAAGTGTGGCCGGGGCATGGCGCAGTTTGGTAGCGC ACTCGCTTTGGGAGCGAGGGGTCGCAGGTTCAAATCCTGTTGCCCCGACGGCAAAGGTTCACCCCTAGTCTTCGGACTAG GGGTTTTCTCGTATCTGGGGTAAGCCTTAAGTTCTAGGGGTGCTTGTTCAGGGGCGAACCGCAGAGCTTGATGATGGTCC AAAGCCATGCGAGGTAAGGGATCGCGCCGCGTCATTAACGGGCGGAGTGGTCAATTTTCCGTGATTTCCGCCCGGCGGAA ACACAGCTGGTCTGGTGGCATTAGCCAAAACTAGGTGGGGGTGTGGTGACACGGAAAATCAAGACCCTATAAACTTGGTC GATGTCCAACGCTGACTGGCGACACAGGCCGTCAGC