TRNA32

Coordinates:1648083-1648158

>TRNA32 Anticodon: GTG
GTGACTGTAGTTCAGCTGGTAGAGCACCAGGTTGTGATCCTGGGTGTCGCGGGTTCGAGTCCCGTCAGTCACCCCA

>TRNA32 Anticodon: GTG
GTGACTGTAGTTCAGCTGGTAGAGCACCAGGTTGTGATCCTGGGTGTCGCGGGTTCGAGTCCCGTCAGTCACCCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1647583 - 1648658 (Additional range around TRNA32 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GAGCGGGCCGCGCCGCTAGCGGGCAACTCCATCGGCACGGATCGCCGCTTCATCGCGAAGTACATGCCGAAGCTGGACGA GTTCCTGCACTACCGCATGATCGACGTCTCCAGCATTAAGGAGCTCGCCCGTCGCTGGTACCCCAAGGTGTACGCGGGCC AGCCGCAGAAGGGGCTTTCCCACCGGGCGCTGGCGGATATTCAGGAGTCGATCCAGGAGCTCGCGTTCTACCGGCACGCG ATCATGGTCGACGCGCCCGGCCCGGATAAGGGGCAGATCCTGGCGGCCGCTGAGGCAGCGGTCGAGCCCTGGGCCTAGGC CAGGGAAATCGTTTGGTGCTCGTTCGGCGCTCGCTCATAAGGACGACGCCGCGTTCCGCGGGGTCACTGTTGCGCGGTTG CACGGCGGGGAGCTTCCAGGTTCCGGGGCCTCCACGCTGGCGTTTTGGCGCTTTTGTGGTTCTGGCCTAATATAGTTCTC GCTGTCTTAGAGCAGTGATG GTGACTGTAGTTCAGCTGGTAGAGCACCAGGTTGTGATCCTGGGTGTCGCGGGTTCGAG TCCCGTCAGTCACCCCA GAGAAAATCCCCGGCAGGGTTCTGAACTAGCCCCCGAAAGTTGGACTGGTTTAATTCTAGGC GGTGAGGGGTTCAAGGGTCTGATTCCGATATTGCATCGGGGTCAGGCCCTTGAGTCGTTGTTGGACGCGTTCGGTGTTGT ACCACCCGATGTACTCGTCGATCGCTTGGTTGAACTCTGCGACCGTGTCGAAGACCTCACCGTGGTACATCTCGGTTTTC AAGTGCCCGAAGAAGTTCTCCATGACCGCGTTGTCGTAACAGTTGGCTTTACGCGACATCGACTGAACACCGCCGTTGTC GCCGATCAGATTGCGCCACGAGGAATGCTGGTACTGGAAGCCTTGATCGGTGTGCATCATCCACCCGGGTTCAGGTGCAC ACGCTGCAATCGCCTTGGACAAAGAATCGGTGGTCAACGCTGTCGACGGTGATGTAGCCACAGTGTGGGCAACGATCGAG CGGTCGAACAAGTCCATCACCGGTGACAGGTAGACCT