TRNA33

Coordinates:1652914-1652990

>TRNA33 Anticodon: CTT
GGGCCATTAGCTCAGTTGGTTAGAGCAACTGACTCTTAATCAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCA

>TRNA33 Anticodon: CTT
GGGCCATTAGCTCAGTTGGTTAGAGCAACTGACTCTTAATCAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1652414 - 1653490 (Additional range around TRNA33 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TGCGCTTCCTCCGTGGCGGAGGTGTCACCCTCCGAACGGTCGGTGTCGATCGTGCACGCACCGAGCGTGACGAGGCTGGC TGCTGCGACAGCCGCAACGATGGCGCGACGAGGGTTCAATACACGTCCGGCCTGGCGCTGACCGATTCGCGAAAGAAAGG ACATCATGGGCTCCCAGGTAGGGCGCTGCCGGTTTCCAGCCTTCCCCAGTGATGTCCGCTCACACGATGGGCGGGCATTG GAAACGATCGACAGCAGTTGGTGCGGCCCCTTGCCACGGTGATGGGCGGCGGGTCCGCTGGCAATTTTTAATACCCGGTT AGCTTAGCCGGTCAGGCAGACAAACCGGATGTTCAACGTGGCAAGTGTTAGAACACTGTTATGAAGCCGTTGGTTTTGCG CCACGACCAGGCGATTTGCCAAGTTTTAAAAAGCCTAATATAGTTTCATCTCGTTGCCACGGAGAGCACATGCAAAGCAG TGTTCACCTCGCAGCAAGAT GGGCCATTAGCTCAGTTGGTTAGAGCAACTGACTCTTAATCAGTGGGTCCGGGGTTCGA ATCCCTGATGGCCCACCA CTGACCACCCCCGTCGGGATCATTCCCGCCGGGGGTTTTTCCTGTCTCGAGCCAGCGCGGG TCAACTCCCGTAGCAAAAGCGATAGCCGAGATCAGCGGACGCTTAGGCGTCCTGACCCCCTGCTCCGCATTGGCGAGCGT CGCCCGGCTAACGCCCACAATCTTCGCGAGCTCCGTCTGCGTGAAGCCTCCGATCTCCCGCGCCCGCTGCAGTCGGTGCT TAATCTCCCATTCGGGAATAATCCCTGCATTACTTACTGGTTTCGTCATGCCTAAAGGTTAGCGCATTGGCTAACAGTTG GCAATAAAACCGCTGGTCAGTTCACCAGCTAAGTTAAATGACTAAATTTTAGTTGCTTTAGATTAGTCATTGAGCTAATT TCTAGTCATGCGAGAAATTCTGACAACCTCAGAGGTCGCCGAGCTATTAGGAATCGGACTGAGCACTGTCACTTGGCGGG CTCGACAAGGACGACTCCCCGTCCTGCAACAGATTTCC