TRNA34

Coordinates:1698473-1698554

>TRNA34 Anticodon: TAG
GCGCCTGTGGCGGAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGTCCTAGGACGTGGGAGTTCAAGTCTCCCCAGGCG
CA

>TRNA34 Anticodon: TAG
GCGCCTGTGGCGGAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGTCCTAGGACGTGGGAGTTCAAGTCTCCCCAGGCG
CA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1697973 - 1699054 (Additional range around TRNA34 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CTGCACCAAGGAGGCCTGCGACTTCCGCGACAACCTGGCTCAGCTGAATGACCAGAACATCGACGTGGTGGGCATTTCCC CGGATAAGCCGGAATCCCTGGCGAAGTTCCGCGACAAGTACGAGCTGACCTTCCCGCTACTCTCCGACCCGGACAAGGCC GCCATGACGGCCTATGGCGCCTTCGGTGAGAAGAAGAACTACGGCAAGATCGTCCAGGGCGTGATCCGCTCGACCTTCCT CGTCGACGAGAAGGGCAAGATCGCCCTGGCCCGCTACAACGTCAAGGCCACCGGGCACGTCGTCCGCATTATGAAGGAGC TCGAGGCCTAGGACGTCGCCCCGGTGGCCGTTGCTGGTTCGGTTGCGGCCCCTCTCCTGGCAAGGCTGTTCCCACAGCGC TCGTCCGATCGTGATGCCATGATGAGTTTCCAGCACGGTTAGGTTTTCGCCCCGGCGGCGTTGCTATAGTGTTCCTAGCC GTGGCGGGACACCGCCACCT GCGCCTGTGGCGGAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGTCCTAGGACGTGG GAGTTCAAGTCTCCCCAGGCGCA CTCATCAACACCTCGTGACTATGCAGGTCACGGGGTTTTTTGTTTTCCGCACTCGT TACGCCACGTGGTCAAAATTTCGCCCATTTTCCGCCCAGTTAGACCTAACCCCGTGTCGAAAAGATGCAACTGGTTGTCG AGAATGATGGACTGGTCCGCTTACCCCCCGCTGCCGCCGCACCCGCATGACATTGGCCACCAAGGCGACAAGCAGTGACG CGGCAGTATGGCGAAGGTCATGGCACGAGATAGCCGGCGGGAGAGATTCTCTGCCCGCATGTGCCACGCCATCGCCGGGG CTGTACTGTAGGCGCACCCACGGCAGGGTCGCGGTGACCGTTTTGCCGGAACGGATCATGTGCCGGGTTGGGTCATCACA CATAGGCAGTACCCACGTGATCGGTGTCCCTGCCGCGAATGAGTCGCGGGATGAGCTCGCAGGACTATCGGCCAAGCCTC GTCAATTCTTGAATCCATTGACTAGGGAAGCCCATCTAGTAGA