TRNA35

Coordinates:1743910-1743982

>TRNA35 Anticodon: GGC
GGGGCTATGGCGCAGTTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAATCCCCTTAGCTCCA

>TRNA35 Anticodon: GGC
GGGGCTATGGCGCAGTTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAATCCCCTTAGCTCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1743410 - 1744482 (Additional range around TRNA35 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GTTCGTTTTAATTTTTTGAACTTCCTGGACGACGGCCGTCGTGGTCCGTCGACCCGTGGTGCTGCGGTGGCATACGCCAT CGCTGAGACCGGCAACGTCAAGGCGTTCTGGAACTTCCACAACTACACCATGCTCGAGCAGGAGACCGTTGCACGCACCT GGGACTACGAGGACCTGGCGCAGGCTGCTTCGGCATATGACTTGGACGCTTCGCTGATCGAGAAGATCAAGAATGGCGAG CTGGAGGATAAGGGCGTCGAGGTTGGCGAGGCCAACGCGAAGGTCCTGAAGAAGAAGGTTGGCCAGGTGTCCTCGCCGAT CGTCCTGGTGGATGGCCAGAAGCTCGACATTAAGACCGGCAAGGACGGAATGCTGCAGTCCTGGGTTCCGGACGTGGTCA AGAATTAAATAACCGCAGCGTGAGGGTCGGTTTTTCGGCCCTCACGGCCACCGATTTGGTGGGTTGTGTTCCGGTGGGGT ATCTTTAGATCCGCACCAA GGGGCTATGGCGCAGTTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAAT CCCCTTAGCTCCA CTTAGAGAGAAAACCTCCGGTCTTATCGGCCGGAGGTTTTTTCGTGTTTAGGTGGGGTCTCTGGGG GTTAAACGACAAAATGTGTGTCTGACTCCGGCGTGTCGCGGGGTTAGATGTGGCCTTTTTGGATGCCGATTGAGTGTGTG TAGTCGGTGTCGATAGCGTTGTCGTAGAGGGCTGGTCGTCCGGTTTCGTGGTCGGCTTGGTTCTCGGTTTGGGTCAGGGT GGATACTTTGGCGAGTTGGTCCTGGCCCCAGTTGGACTGCCTGGCGATCTCAACAGGGTCGTCAGGCAGTTCCGTTTGCA GGTACAGCCACCAATCCAGCATCCGGCGTTGGTGTTCACCGGATCTGCCGCGGTGGGTGCGGGCAAGCAGTTTCAACTGG GCGTTGATGCCGCCTTCCAGGCTGTTGGTGGTGGATTTGATCCGGCTGACATCGAGGACACCGTCAGGTGGGTCGAGATA GACAAATAACAGCTGGTTGCGCCACAGGTGGTTG