TRNA36

Coordinates:1783149-1783221

>TRNA36 Anticodon: CCT
GCCCCAGTAGCTCAGTGGATAGAGCACGGCTCTCCTAAAGCCGGTGTCGGAGGTTCGATTCCTCTCTGGGGCG

>TRNA36 Anticodon: CCT
GCCCCAGTAGCTCAGTGGATAGAGCACGGCTCTCCTAAAGCCGGTGTCGGAGGTTCGATTCCTCTCTGGGGCG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1782649 - 1783721 (Additional range around TRNA36 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GGCGTTCTGCATCGCTGCATCCGCTAACCTGCCGACGATCCTGTACTCCCTGTACTGGAAGAAGTTCAACACCACTGGCG CCGTGGCCTCCCTGTGGGTCGGCCTGGGCGTGGCGCTGGTCCTGATCTTCTTCTCCCCGGCTGTCTCCGGTGCAGAGACC GCGATGTTCCCGAACGTGGACTTCTCGTGGTTCCCGCTGACTAACCCGGGTCTGGTCTCCATCCCAGCTGGCTTCATCGC CGGTATCGTGGGCACCTACCTTGGCAAGGGTGACGAGGATCCGAAGCTGCAGTCCGAGATGGAGGTTCGCTCCCTCACCG GTGTTGGTGTGGAGGCTCCGGTCGACCACTAAGCCACTCCCCTAGGCTCCTCGCCTTGGATAAGCCCAGCCACTTGGTCA ACGGTGGCTGAGCAACACCCCCGCCGCATCTGGCTAGTTCCGGAAGCTGCGGGGGTACCTTGTATCATGAGTGGTCGTGC CCGCAGGGTGCGGTCGCACA GCCCCAGTAGCTCAGTGGATAGAGCACGGCTCTCCTAAAGCCGGTGTCGGAGGTTCGAT TCCTCTCTGGGGCG CTTTTTTGTTTTTTGCCCTCAGCTTGACCATCACTAGTCCCACCAACCCACCCACCTACATTGTG TTAGCCTAACCTAAGAATAAGGCGTGGGTGCGGGCATTCTCTTCCCACAGCACCCCAGTGTTTGAAGGACAGTGATGGTT ATGGCTGCCCAGCCGCAAAACTCAGCGCCGAAGCGCAAACCCCGTAAGGCCAACGAAGCAACCGTGACTGGCCGTCGCCA GCTCTCGCCGGATCTCGTTCGTTTGAGCTTGAACTCTCCTGCATTTGTGGGCAAGCAGCTGGAGTTTACAGATCACTACA TCAAGTTCCTCTTCGCGCCAGAGAGCGCCGATTACTCGTGGCCATTCGATCTCGAAAAGGTCCGCGAGGAGCAGCCCAGG GAAAACCAGCCAGTGACCCGAACCTACACCCTGATTAACCTGGACCCAGCAACCGGGGACTTCGACGTGGACTTCGTCAC CCACGGTGATTCTGGCCTGGCCGCTCCCTGGGCA