TRNA37

Coordinates:1867778-1867850

>TRNA37 Anticodon: GAA
GGCCAGATAGCTCAGTCGGTAGAGCGTTCGCCTGAAAAGTGAAAGGTCCCCGGTTCGATCCCGGGTCTGGCCA

>TRNA37 Anticodon: GAA
GGCCAGATAGCTCAGTCGGTAGAGCGTTCGCCTGAAAAGTGAAAGGTCCCCGGTTCGATCCCGGGTCTGGCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1867278 - 1868350 (Additional range around TRNA37 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CTGCGATGGGCGATGGATGCGGGCGGGGCGTAACGGCACTGATCACGTGTGGGTCGAACGTTTCGACGGCGCCGAATGGG GTGAGGTGGAAGCCGACGGGGTGACCACCTCCGGCATGCAGGGGCCGTGCTTCTCCGATGCTCGGCTGCGCCGCCTCGGT GCCCCCGAAAAACTGATCGACATGGTGACCCTCTGCGATTAGTGCCAATTAGTGTCATCGGTACCGGAGCTGCGGGAGCG CTAAGCTGCCATGGTGGAGGGGTAAAACCTATAAAAAGCAGCTTGCATGGCCCGAAAAGGCGCCCTTTAAAATGCCTATC TACCTGCTGCGATGTGTGCATGTTGGCCGTGATTTGTGCCCACGTTAACCGCTGGGTATAGTTACCACTCGTGCGATAGC ACACGGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCGTCAGGGTCGCT GTGAAGCCTCAGGCTTCTC GGCCAGATAGCTCAGTCGGTAGAGCGTTCGCCTGAAAAGTGAAAGGTCCCCGGTTCGATC CCGGGTCTGGCCA CACTCCCAGCCCCATCCCAACGGATGGGGCTTTTGCTTTATAGTTGCATGCCTTAAGTTCTAGGGG GGGTAAGGGGGTTAAACGACAAAAGGGGATGCGGACGGGATCTTGGAGGATTCCACTTATGAACCGTTCGTACACAGATC AGCAGCGTCGCAGAGCGATTGAGGTTTATAAGCGCACTCAGTCGGTGACGAAGACGACCCGGCAGCTGGGGTATCCGGGG AGATGGACGCTGTACAAATGGTTGCGTGAACCCACCACTCCAGGTAGACCGCGTAAGCAGGCGAAAACCTTGACGCGTTA CCCGTTTGAGGTCAAGCTTCGTGCTGTCGAACTTTTCAACGCCGGCTGGAGCCCAGCTGACATCGCTCAAGAATGTGGGC TGAGGTCAAAAATGAGCGTCTATTCTTGGACACAACGCCATCGTGAAGAGGGACAATGGGGGCTGATGTCGAAAAAGGAA CGAGAAGAACGTGCTCGCATCCCCACCCGAGCAG