TRNA38

Coordinates:1867872-1867945

>TRNA38 Anticodon: GTC
GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCGTCAGGGTCG

>TRNA38 Anticodon: GTC
GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCGTCAGGGTCG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1867372 - 1868445 (Additional range around TRNA38 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGCGCGCGGCCGAAACCGCAGCGCGTGAAGAAGGGCGAGTGCCCCTATCTTGAGTCCAACTCGAACACCCGACCCGGTGA AATCGTCTCCATGTACTGCGATGGGCGATGGATGCGGGCGGGGCGTAACGGCACTGATCACGTGTGGGTCGAACGTTTCG ACGGCGCCGAATGGGGTGAGGTGGAAGCCGACGGGGTGACCACCTCCGGCATGCAGGGGCCGTGCTTCTCCGATGCTCGG CTGCGCCGCCTCGGTGCCCCCGAAAAACTGATCGACATGGTGACCCTCTGCGATTAGTGCCAATTAGTGTCATCGGTACC GGAGCTGCGGGAGCGCTAAGCTGCCATGGTGGAGGGGTAAAACCTATAAAAAGCAGCTTGCATGGCCCGAAAAGGCGCCC TTTAAAATGCCTATCTACCTGCTGCGATGTGTGCATGTTGGCCGTGATTTGTGCCCACGTTAACCGCTGGGTATAGTTAC CACTCGTGCGATAGCACAC GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAG TCTCGTCAGGGTCG CTGTGAAGCCTCAGGCTTCTCGGCCAGATAGCTCAGTCGGTAGAGCGTTCGCCTGAAAAGTGAAA GGTCCCCGGTTCGATCCCGGGTCTGGCCACACTCCCAGCCCCATCCCAACGGATGGGGCTTTTGCTTTATAGTTGCATGC CTTAAGTTCTAGGGGGGGTAAGGGGGTTAAACGACAAAAGGGGATGCGGACGGGATCTTGGAGGATTCCACTTATGAACC GTTCGTACACAGATCAGCAGCGTCGCAGAGCGATTGAGGTTTATAAGCGCACTCAGTCGGTGACGAAGACGACCCGGCAG CTGGGGTATCCGGGGAGATGGACGCTGTACAAATGGTTGCGTGAACCCACCACTCCAGGTAGACCGCGTAAGCAGGCGAA AACCTTGACGCGTTACCCGTTTGAGGTCAAGCTTCGTGCTGTCGAACTTTTCAACGCCGGCTGGAGCCCAGCTGACATCG CTCAAGAATGTGGGCTGAGGTCAAAAATGAGCGTC