TRNA39

Coordinates:1870260-1870333

>TRNA39 Anticodon: GTC
GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCGTCAGGGTCG

>TRNA39 Anticodon: GTC
GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCGTCAGGGTCG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1869760 - 1870833 (Additional range around TRNA39 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TGCAGTATTTCTTCGACGACGCAGAATTCGATTTCACGGAGCGCTTCGCCAAGGCAGAGGGTCCCGTGTTGTCGGTGGTC ATGGGGGACGACCTCTGGGCGCACCGGGGCGCGGTGAATGTTCTGACGGATAGGTTGGACCGTGCGGACGTCCTTAAAAA AGACATCGAAGCGGGTGAGGGGACCGCAAATGGGCCAGTGGGGCACATGGGTTTCTACCGCTCGAAGCACCGGGATCTGT GGCCGGATGTGGCTGAGTGGTTGGAGGCACAACTCTAGGAATTGCGTCGCGCGGCGTGGCACAGTATCTTGTTGAGACGA ACCCAGTGGTCAGAAAATCCCCTCGTCACATGGCAATTTGGTTGTTGTGCGGGGAGCGGGTTAGACTGAGCGAGCTGTTT GAGACGCGTAGAGCGTTTTGAACGTGCTCCCATCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACACGGGTT CGAATCCCGTTGGGAGTAC GGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAG TCTCGTCAGGGTCG CAGCAAGATCAACCCCAAGCTCTTCGGAGCTTGGGGTTTTTGCTTTGCCATTTATCTTGCGCCCG GCCCGGTCGTGGCGCACGGGATAGGGGGTTCTGCGCAGGCAGCCAGGTAATCTCTTGCCCATGAGTTCCTCCAAGACCTC GTCGTATCACCTCTTCCGCCGGTGGCAGGGCGCGACGTTCACCAAGCTTGGGCTGCTAAGCGAGAGCATGTCCGTGGCTA CTGCATCGAAGTTAGTCACACCCCTAGCGGTACTCATTCCGGTGCTCGCAGCCCTCGCGGAGGCCCAGGTTCTCACCGCC TCCGCCTGGTGGCTGACATTGGGCGCCATCGTGGTGGGTGTGCTGCTGTACTGGATTGCGACGATTGGTCTCGAAAATCG CCAGCGCTATAACTACGCCGTGCGTTCACGCAAGGAGCTCACGTCCCGCAAAAATCGCCTCGGCGAGCCTCTCGGACTAT CAGCGTGAGCACGATTTCGAGAAGCGGGAGGTCGA