TRNA4

Coordinates:329803-329885

>TRNA4 Anticodon: GTA
GCCAGATTGTCCGAGCGGCCAAAGGAAGCGGACTGTAAATCCGCCGGCTTATGCCTTCGTTGGTTCAAATCCAACATCTG
GCA

>TRNA4 Anticodon: GTA
GCCAGATTGTCCGAGCGGCCAAAGGAAGCGGACTGTAAATCCGCCGGCTTATGCCTTCGTTGGTTCAAATCCAACATCTG
GCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 329303 - 330385 (Additional range around TRNA4 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CAGATCTTCCAGATCGTGGACGACATCATCGATATCTGGGCGGATCCCGAGGAGTCCGGCAAGACGCCGGGCACGGACCT GCGGGAGGGCGTGTTCACCCTTCCGGTGCTGCACGCGATGCGTCAGGAGGACGAGGTCGGCGCCCGGCTGCGCGAGCTGC TGACCGGCCCGGTGACCGACGATGCGGTGGTCGAGGAGTGCCTGGAGCTTATCCAGCGTTCCAACGGCCGTGAGCTCGCG GAGCAGGACGTGGAACACTACCGTGGCCTGGCCGACGAGGAGCTGGCGAAGCTGCCGGATAACGAGGTCACTGAGGCGCT GCGCCACCTGCTGGCCTTCTCGCTGGACCGCCTGGGCTAGTTCGGTTTCGGTTGGGCGGTTGCCCACCGTATCCCGGTTG TTCCGCCTTCCTTTTAAGGACGTCAATACCTGGCCCGAGCAGCGCGTTTAGGGAATCTTTGAGGCGCGTAGTAGGGTATT GAGCGCACCAAGTGGTGTAC GCCAGATTGTCCGAGCGGCCAAAGGAAGCGGACTGTAAATCCGCCGGCTTATGCCTTCG TTGGTTCAAATCCAACATCTGGCA CAGACGAACTCCGTCAGGGAAAACCCTGGCGGAGTTTTTGCGTTGGGGTGTGTGC ATCTCCTCCTGTGGCTCTGCTTCCGCGAATCGGATGAAAATGGAAGTTTTCGGGGCTTTCCCTCCGTTTTCATCCGATTT GCAGTCGCCTCGCTCTAGGCCCACCTCCCCGCCTCCCCGCCACTCCGATTCGCCTTCCCCTTCCGCGGTGCTGACGGTTT TTGTCGATTTTTGCCTCGAAAGTGACAAAACGATCAGCAACGGGAGCGGCGCTGGAACCGTTAAGATGATCTGGTGACAA ATAACCCCTATGAAGGCACTGGCTTTGTCGGCCGCGATGCCAGTTCCGCGGAGGATCATCGATCATCGAGCGCGCCTTGG CCGGAGTATCGGACGCCTGCGCCCCGGCAGGTCCATAACCCGTATCTTGCGCATCTGGAGGACTTTCAGGACGCGCCAAT GTCCGTAGCCGCTGGCAGCCCTGCAGGGGGTATGGGGTCCGGTG