TRNA40

Coordinates:1870335-1870407

>TRNA40 Anticodon: TTC
GCTCCCATCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACACGGGTTCGAATCCCGTTGGGAGTA

>TRNA40 Anticodon: TTC
GCTCCCATCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACACGGGTTCGAATCCCGTTGGGAGTA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1869835 - 1870907 (Additional range around TRNA40 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TCCGTGGCACAGGGGACTCCGCGACTCCGGGCGATTCGGCGTGATGCTGCAATGGCGGCGCTGGGCAGGCCAGATGCAGT ATTTCTTCGACGACGCAGAATTCGATTTCACGGAGCGCTTCGCCAAGGCAGAGGGTCCCGTGTTGTCGGTGGTCATGGGG GACGACCTCTGGGCGCACCGGGGCGCGGTGAATGTTCTGACGGATAGGTTGGACCGTGCGGACGTCCTTAAAAAAGACAT CGAAGCGGGTGAGGGGACCGCAAATGGGCCAGTGGGGCACATGGGTTTCTACCGCTCGAAGCACCGGGATCTGTGGCCGG ATGTGGCTGAGTGGTTGGAGGCACAACTCTAGGAATTGCGTCGCGCGGCGTGGCACAGTATCTTGTTGAGACGAACCCAG TGGTCAGAAAATCCCCTCGTCACATGGCAATTTGGTTGTTGTGCGGGGAGCGGGTTAGACTGAGCGAGCTGTTTGAGACG CGTAGAGCGTTTTGAACGT GCTCCCATCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACACGGGTTCGAAT CCCGTTGGGAGTA CGGCCCTGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGAGTTCAAGTCTCG TCAGGGTCGCAGCAAGATCAACCCCAAGCTCTTCGGAGCTTGGGGTTTTTGCTTTGCCATTTATCTTGCGCCCGGCCCGG TCGTGGCGCACGGGATAGGGGGTTCTGCGCAGGCAGCCAGGTAATCTCTTGCCCATGAGTTCCTCCAAGACCTCGTCGTA TCACCTCTTCCGCCGGTGGCAGGGCGCGACGTTCACCAAGCTTGGGCTGCTAAGCGAGAGCATGTCCGTGGCTACTGCAT CGAAGTTAGTCACACCCCTAGCGGTACTCATTCCGGTGCTCGCAGCCCTCGCGGAGGCCCAGGTTCTCACCGCCTCCGCC TGGTGGCTGACATTGGGCGCCATCGTGGTGGGTGTGCTGCTGTACTGGATTGCGACGATTGGTCTCGAAAATCGCCAGCG CTATAACTACGCCGTGCGTTCACGCAAGGAGCTC