TRNA41

Coordinates:1871945-1872017

>TRNA41 Anticodon: TTT
GGGCCTTTAGCTCAGTTGGTAGAGCTCCGGACTTTTAATCCGTAGGTCGTGGGTTCGAGCCCCACAGGGCCCA

>TRNA41 Anticodon: TTT
GGGCCTTTAGCTCAGTTGGTAGAGCTCCGGACTTTTAATCCGTAGGTCGTGGGTTCGAGCCCCACAGGGCCCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1871445 - 1872517 (Additional range around TRNA41 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGCATCATGAACGGCATTGGCGGTTCCGGTGACTTCACCCGAAACGCCTTCCTGTCGACCTTCATCTCGGGCACGATCGC CAAGGACGGCGCGATCTCCACGATCGTTCCTTTCGCATCCCACATCGACCACACCGAGCACGACGCCATGGTCATCATCA CCGAGCGTGGCTACGCCGACCTGCGTGGCCTGGCGCCGCGCGACCGTGTGAAGAAGATGATCGAGATCGCTCACCCGGAT TACCAGCCGCTGCTGGAGGAGTACTACGAGCGCGCGAAGTCCAAGGGCACTGGCCTGCAGACCCCGCACGATCTGGCCAC CGCTTTTGATTTCCACATCAACCTGGCGGAGAAGGGCAGCATGAAGGGCTAGTCTTTAGCCATCTCGCGCACCTAACCCG TCCCGGTTTTCGCCGGGGCGGGTTATTTGTTTTTCGTGCCTCGCCATGGGGTAAGCTGTGTTCCGCAAGCGTGGCTTGTG TGCGTGCGATTGTGCGCGT GGGCCTTTAGCTCAGTTGGTAGAGCTCCGGACTTTTAATCCGTAGGTCGTGGGTTCGAGC CCCACAGGGCCCA CTTCTGTATTCCCCGGTCTTTTCTGGCCGGGGATTTCTTATATGTGCTTCCGATGCGTGGCATCTT TGCAGGCCTAATGAGCAATTAGGGGCCGGTGACCGAGGGAGCTCTAATACCCCGCCGCGGCACATTCCGATGGTTCGATA TAACCCTGTTCGCAGCCGTGCTGGAACTGAAGCTCACCGCTACTCGGGTAGGGGTTGCCGTTCTCGTCGTGCCCATATCC GCACTTGTAGGCCGGGCAGGTTCCGCCATTTGCGAAGGGAACTTTCGATGGATCCCAACCCGCTGCTGCTTCTGCATCGC GGTAAGTCTGTGCGCCAGGTTGGTTAGCGCAGTAGTCCGTGTATTGGGTGCTTCCATCGGACATGCGTGAGGGGCCTGGC GTTCCGGGGAGACATTCGAGGACGTAGATTTCGGCTGCCGGTGCTTGTGTCTGCTTTGGGGCAGCAGCGGGCTCCGTGCT GGGGCTGGGGGTTGCGGTCGAGCTGCTAGGGGTC