TRNA42

Coordinates:1925251-1925323

>TRNA42 Anticodon: TGT
GCCGAAGTGGCGCAATTGGCAGCGCAACGCACTTGTAATGCGTAGGTTGCGAGTTCGAGTCTCGTCTTCGGCT

>TRNA42 Anticodon: TGT
GCCGAAGTGGCGCAATTGGCAGCGCAACGCACTTGTAATGCGTAGGTTGCGAGTTCGAGTCTCGTCTTCGGCT


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 1924751 - 1925823 (Additional range around TRNA42 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCGTGAGGCGGGAGAAATTCGTGCTGAGGGTCTTCACGACCCGGAAGGCGGACACGGGGCTGCGGGACTCGTCGTTGTGG GCGTACACGGTGATGGTGTTCAGCGTGATGTCCACGTGCGTGTAGTGCAGTCCGTAGGCGGCCGCGATCGCTTTGATCTC CGCCTTCGCGTCCGAGTTGCCGGTGCCGGCAGCCAGCAGCTGGTCCCCAATGCGTGCGGCAAGGTTCAGGACGCGGTGGA TTTCCTCCGGGTCCGTGAGGTTCACCGGGGCCAGCGGCGTGGGTGGCGGCGCTAACCGAATTCCGTCGATGGTCGCGCGA TTGCCAGTAAAGAGCATGTCGCTGGCGTGTCGGGCGAACCGAGCTAGATAATGTGCCACAACAACACCGTACACAAGGCC CCTCCCGCACTGGAGGTGATGGTGGGCCTAAAAATTCGTGGGCTTCTGTGGTGGGCTGCTACTCTTTAAGCGCCCACGCC TCGTATGAGCGATGGGTGT GCCGAAGTGGCGCAATTGGCAGCGCAACGCACTTGTAATGCGTAGGTTGCGAGTTCGAGT CTCGTCTTCGGCT CGGTGAAAGGTGGGTTAAGTAGCAAAAAGTGTGTCTGCTCGGCGTGTCGCCGGGTGGGCCCTTTTT ATCTCATGGGCCCTTTCCGGATTCCTATGTTGTGTTGGTATTCGGTTGGGATAGCGTTGTCGTAGAAGGCTGGTCGTCCT GTTTCGTGGTCGGCTTTGTTGTGGTCTTCTGGGACAAGGTCGTTGACTTTGGCGAGTTGATCTTGTCCGTAATTGCACTG CCTGGCGATCTTTAGCGGGTCGTCAGGCAGCTGCGTTTTCGAGTGCAGGTACCACTCGAGCATTTTGCGTTGGCGCTCCC CGGATCTGCCGCGGTGGGCATCGGCGATGCGTTTGAGCTGGGCGTTGATCCCGCCTTCCAGACTGTTTGTTGTTGATGCC CAGCGCTTTGGTTCGAGTGCTTCTGGTGGGGGCTGGAGGAAGGTAAACAGCCATCCTTTCCGTGAGAGGTGCAGCAGGCA GTGGTAGGCCTTGCGGACCCACAGGTGGGTCCAT