TRNA43

Coordinates:2130607-2130677

>TRNA43 Anticodon: CCC
GCCGATGTAATTCAATGGTAGAATGTCAGCTTCCCAAGCTGAATACGCGGGTTCGATTCCCGTCATCGGCT

>TRNA43 Anticodon: CCC
GCCGATGTAATTCAATGGTAGAATGTCAGCTTCCCAAGCTGAATACGCGGGTTCGATTCCCGTCATCGGCT


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 2130107 - 2131177 (Additional range around TRNA43 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGGCCTGCCAGGTGATCGGGGATCGTGAACTTCTCAAGCGTCGCGCCGAGGACGAACTCCCCCGGGTGCAGGATGAAGGG CTCCTCGCCTTCCACCTCCACGAGGGTGGTGAGCTCCTCCTGCGGCAGCTTCGGGTCGATGTGGGTGTACCGGGAGTTAT TGAACACCCGGAACAGGCTATCCAGCCGCACGTCCACAGAGGAGGGCTGCACCATCGAGGCATCAAAAGGCTCGATGCCG AGCTGACCGGCGGCGATTTCTGAACGGAGGTCACGATCTGAAAGAAGCACGTCTCCCAGTCTAACCGAGCAACCCGCGCC GAACCCCCACACCACTGAGCGGGGCTCAGATTGGGCCACCGAGCGACAGCCGGATCGAGCCACCGAGCGACAGCCGGGTT AAACCATTGTGCAGCGGCCGACGCGACGCTAACGGCCTGGCCTTTTGGCTGCTCCCCGACGCGTGCCCTATACTTAATCG CTAGTGTCCAGGACACATTT GCCGATGTAATTCAATGGTAGAATGTCAGCTTCCCAAGCTGAATACGCGGGTTCGATTC CCGTCATCGGCT CAGATTCCCCCGGTGGGCATATGCGCACCGGGGTTTTCGCTATCCCGAGCCATAAAATCCACCCCTC CCCGCTACACTCATATCCACCATCACCCTGCCGAATCCCTACCGGCAGGCCGGGCGCCGGGGCGAGGTTGACGTCCTAAA ACTAAAGAGCGCCCCTGGGGCGGAGAAGGAAGGACCACGACGATGGCGCAGCAAGCCAGTCGGCAGGCCGACGAGCATGC CAGCGGGCAGGGACTGACGCGGATCAGCGACCAGGAGAACCCCTACCCGGTACCGGAGAAATACCCGGAGTATCAGCCGA AGAACGATACGACGAAGGGGCAGCGCAAGCTCTCCGTCTACACCGCTATCGACGCCCTCTTCATCATCGTCACCCTCGCC CTGACCGCCTGGTACCTGGCGCTGATGATCCTCAACGGCTTCAACATGGAAACCAAGAGCCTGATCTGGGTGATCTGGTG GTTCCTCGTGCTCGCGTACCTCTCGCTGCCGC