TRNA45

Coordinates:2175703-2175779

>TRNA45 Anticodon: CGG
CGGGATATGGCGCAGTTTGGTAGCGCACCTCGTTCGGGACGAGGGGGTCGCAGGTTCAAATCCTGTTATCCCGACAA

>TRNA45 Anticodon: CGG
CGGGATATGGCGCAGTTTGGTAGCGCACCTCGTTCGGGACGAGGGGGTCGCAGGTTCAAATCCTGTTATCCCGACAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 2175203 - 2176279 (Additional range around TRNA45 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TGGATGACCCGCACCACGACCTGGCGGACTACTCGCAGGTGGCGGGTGCTCCGAATGCGGATGCGGACTTGAGCATCGGG CTGTCGCACTCCCCCGAGCCGGCGGTGCTGGATCAGTTCGCGGCCGATGGTTATCAGCTGGTGCTCTCCGGACATACTCA CGGCGGGCAGTTGTGCCTGCCGGGGAGCCGGGCGATCGTGACGAATTGCGGCATCGACCGGTCCCGCGCGCAAGGGTTGT CCCGGTGGACGGAACGGACGTGGCTGCACGTGACAAACGGCCTGGGGAACTCGAAGTACGTTCCCTTCCGGATTTTCTGC CGCCCGTCCGCGACGCTGATCCACGTGGTGGAGCGGGAGGACTAGCGGGCACGAGCTGCGTTCTTAACCCTTAAACCCAC CCCGGTTTTTCCCTTCCGGGGATCACGCGTTATAGTAAGGAACCGTTGCGGAGATCTTCCGGCCGGATCATCTGGCAGAA GAACCCTCGCAGCCTATGAC CGGGATATGGCGCAGTTTGGTAGCGCACCTCGTTCGGGACGAGGGGGTCGCAGGTTCAA ATCCTGTTATCCCGACAA GTTGATTAAAGCCCTGGCCTTCCGGCCAGGGCTTTTCTCGTATTTGCTGGTCGAGGCGGAT TCTAGGGGTCGTTGCAACATTTCCTAGCTTTCAGCTAAATCTAACAGCTCCGCCATCCGCTCCGCAGGAGTAGCAAAACC CAACGTCTTACGCGGCCGACAATTCAACCGATGAGCAACAAGCTCCAACTCCTCCCGCCCATAAACACTCAAATCCGCAC CCTTCGGAAAATACTGACGCAACAACCCATTAGTGTTCTCATTCGTCCCCCGCTGCCACGGCGACCCCGGATCACAGAAA TACACCGGACAATCCGTCGCAATGCTAAACGACCTATGACCAGCCATCTCTGAACCCTGATCCCAGGTCAACGACCCCCG AAGATGCTGCGGCAACGTCATAATCGCCTCCACCAGCGCATCACGCACCGCCACCGCACCATGCCCATCCGGCAAATGCA GCAACATCACATACCGCGTCGTCCGCTCCACCAACGTC