TRNA46

Coordinates:2244182-2244267

>TRNA46 Anticodon: GGA
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGGCTCACGCCCCTCGAGGGTTCAAATCCCTCAT
CCTCCG

>TRNA46 Anticodon: GGA
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGGCTCACGCCCCTCGAGGGTTCAAATCCCTCAT
CCTCCG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 2243682 - 2244767 (Additional range around TRNA46 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TTCTCGCTCGCGTGGTCCTTGTGGGCTGCCGCCGGTGATTCCTCGGGACTGTGGGCTGCGGGCTTGGTCTTCCTGCTCGT TGGTTGCCTGATCGGGCTGAATTTCGTGGGCCTGATGGTGGCGTCCGTGCGTGCGGAACGGGCGCGCGATCAGCAGGCTG GCAGGTAGCGGCGAAGTTTTTGGGCAAAATAAAAGGACCCCGCGCACCCGTGAGAGCTCGTTGACCCTTGCTGCATTCCT GCCCTGGGGGAGTTCACAAGATGCACGCCACGCGGAATCCGCCTAAAGCATAACGCATCGCCACGGCCCTGGCCAACGCT CGCATCTGTGCGGGCGTTGGTGTGGGGGCGTGACGGTGTCGGGTTGGCCCCGTGGGGTTAGAGGCTGGTCTGACTGGACC GACCTCATAGCGCTTTCGGGGCCATCCCTCGCGTGACCGGAAAATGCTGCGAGCGCTGGGGATTTTGTGCGCTTGGTGGC CCTGGGTATAGTAGTCAGC GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGGCTCACGCCCCT CGAGGGTTCAAATCCCTCATCCTCCG CAGTTGGGAAACCCCAGGTAGTTCGCTACCTGGGGTTTCTTTTTATTGAGGCG GGGTGCCTCGGAGGGTTAAACGACAAAATGTGTGTCGGGTTAAGGGTCAAAATGTGTGTCTGGCTCGGCGTGTCGCGGGG GTTAGATTTGGCCTTTTTGAATGCCGATTGAGTGGGTGTAGTCGGTGTCGATAGCGTTGTCGTAGAGGGCTGGGCGTCCT GTTTCGTGGTCGGCTTGGTTCTCGGTTTGGGTCAGGGTGGATACTTTGGCGAGTTGGCCCTGGCCCCAGTCGGACTGCCT GGCGATTCGTACTGGATCGTCAGGCAGTTCCGTTTTTAAGTAGAGCCACCAATCCAGCATGCGGCGTTGTCGTTCGCCTG ATCTGCCGCGGTGGGTTCTGGCGAGCAGTTTGAGCTGGGCGTTGATGCCGCCTTCTAAGCTGTTGGTGGTGGATTTGATC CGCTCGGGCGCAAGGACTCCTGCTGGCGGGTTGAGGTAGACAAACAG