TRNA5

Coordinates:339484-339556

>TRNA5 Anticodon: GGT
GCCCCCTTAGCTCAGTCGGCAGAGCGTTTCCATGGTAAGGAAAAGGTCGACGGTTCGATTCCGTCAGGGGGCT

>TRNA5 Anticodon: GGT
GCCCCCTTAGCTCAGTCGGCAGAGCGTTTCCATGGTAAGGAAAAGGTCGACGGTTCGATTCCGTCAGGGGGCT


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 338984 - 340056 (Additional range around TRNA5 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CCTGAATCGGCAGCATGCAAGGTGCAGGCGAATGTGAAGTTGAAAATTCCGCGCCGCGTGGGATTCGCAGACGGCGGGGC GTCGGCGCGTCGGAACGCTCGCAGGCGCTCGTCGGGGCCGGGCCGCAGGCCGCAAGCGAAGGGCTCCCGGGCGGCGCGGA ATAAAATGATTGAGAGGACTCGAACCTCCTTGCCCCGTGAGGGGTGTGCCATGCGCCGGACGGTGCATCATCCGGAAAGC GCCTGAATTAAAACCCCAGGACGCCCCTTAACACCCGAAAACGGCGCAACTAGAAACTATAAAACAGCTGGCCCGCCCAG CGGAAGAGGCAATCGCGCGATCCACCGCCTAATGCCACCCAAGACGCAGCCATACCGACCGCGGAAACCAGCTACGACGT GCAGATTTGTGCTTCTTATTGGAAACTGGTTATGCTACTTCAGGCTTCGATCAACGGGCCACAGCGAATTACTTCGCTAG GTTCGGTCGATTTAAGTTGC GCCCCCTTAGCTCAGTCGGCAGAGCGTTTCCATGGTAAGGAAAAGGTCGACGGTTCGAT TCCGTCAGGGGGCT CTGTCATTTTATGTGGCCGTCACGTGACCTGTTTACGCTGGCCGTGGCTGGTCGTGTAAGTGGCT GTGGCGGTGTAGCTCAGCTGGTTAGAGCGCACGACTCATAATCGTGAGGTCCCGGGATCGAGTCCCGGCACCGCTACTGA TTTAGGACCCCGTGGTTTTTCCGCGGGGTCCATTTTTTTTATTGACGACGCCACCCTCACCGCCGCCTTGGTTCGCCGCG TTCCATGGGGAGCAGTCGGATCCGGGGCTGGAGCGCGCCCAACCTCGCGTGTTCATGCCTCCAACGAGTGCGGTCGTGCT GCGGAAAACGTGGCAAGTTGTCTAACTGAATGGAAAATTGCTAGGCTACTCCCGTGTTGCACGCATGGTGCGTTGTCTGC GGGTAAAATCGCGGTCACCAACCCGGCGTTGCCACAGTTTTAGGGGTGTAGCTCAATTGGTAGAGCAACGGTCTCCAAAA CCGTAGGTTGCGGGTTCAAGTCCTGTCACCCCTG