TRNA7

Coordinates:339983-340058

>TRNA7 Anticodon: CCA
AGGGGTGTAGCTCAATTGGTAGAGCAACGGTCTCCAAAACCGTAGGTTGCGGGTTCAAGTCCTGTCACCCCTGCAA

>TRNA7 Anticodon: CCA
AGGGGTGTAGCTCAATTGGTAGAGCAACGGTCTCCAAAACCGTAGGTTGCGGGTTCAAGTCCTGTCACCCCTGCAA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 339483 - 340558 (Additional range around TRNA7 is :500nt.)

>Corynebacterium urealyticum DSM 7109 CGCCCCCTTAGCTCAGTCGGCAGAGCGTTTCCATGGTAAGGAAAAGGTCGACGGTTCGATTCCGTCAGGGGGCTCTGTCA TTTTATGTGGCCGTCACGTGACCTGTTTACGCTGGCCGTGGCTGGTCGTGTAAGTGGCTGTGGCGGTGTAGCTCAGCTGG TTAGAGCGCACGACTCATAATCGTGAGGTCCCGGGATCGAGTCCCGGCACCGCTACTGATTTAGGACCCCGTGGTTTTTC CGCGGGGTCCATTTTTTTTATTGACGACGCCACCCTCACCGCCGCCTTGGTTCGCCGCGTTCCATGGGGAGCAGTCGGAT CCGGGGCTGGAGCGCGCCCAACCTCGCGTGTTCATGCCTCCAACGAGTGCGGTCGTGCTGCGGAAAACGTGGCAAGTTGT CTAACTGAATGGAAAATTGCTAGGCTACTCCCGTGTTGCACGCATGGTGCGTTGTCTGCGGGTAAAATCGCGGTCACCAA CCCGGCGTTGCCACAGTTTT AGGGGTGTAGCTCAATTGGTAGAGCAACGGTCTCCAAAACCGTAGGTTGCGGGTTCAAG TCCTGTCACCCCTGCAA AGTACGCCCGCCCATGCGGGCGCCCGAAGGAGTAACCACGTGAGCGAAGATAGCAACAGGGC CGAAGGCTCCGGAGCGAACGCTTCCGGAGGCTCCATGCGCCCCAGCGGTAAGCGTCAGGTCGCTGGCCAGGCCACCACGG CTCGCGCGACCAGCGCTTCGACCTCCCCCGAGGTCGTCGAAACCCGGAGCAACCCATTCACCGCCATCGCGGATTACCTC CGTGGCGTGATCTCCGAGATGCGCAAGGTCATCTGGCCGACCGGCCGCGAGATGGTGACCTACTCCCTGGTCGTGCTGGT CTTCCTCATCCTGATGACTGCTCTGGTTGCTGGCGTGGACTACGTCACCGGCCTCGGTGTTCGCTGGGTCTTCGGCGTCT AGCCGTAACTGTCCCGCTAAGCGCAGCGGTATTATTCAAGCCCTCCCACGTGGAGGGCTTTTCTTGTGCCTTTTCCCGCC ACACCAGCGCGCTCGTGGGTTAAGGGTCAAAATGTGT