TRNA8

Coordinates:623238-623314

>TRNA8 Anticodon: CAT
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCGAATCCTGCCCCCGCTACCA

>TRNA8 Anticodon: CAT
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCGAATCCTGCCCCCGCTACCA


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 622738 - 623814 (Additional range around TRNA8 is :500nt.)

>Corynebacterium urealyticum DSM 7109 GGGCATCGACCCGGCAGCGGCCACGGACCTGGAAGAGGTCGACGGCAGCGTCGTGGCCCCAGGCAAGGGCGATAAGAAGG ACGAAGGCGAGTCCGGTAAGGGCGAGGATAAGGACCAGGAGCAGGGCTCCGGGGCGGCCGGTCAGCTGCCACAGGGCGAC GCTGCTGACAAGGTCCGGGATGCGATGGACAAGGTCAACCGCACCCGCCAGTCCGGCTCCTTCGAGGAGTTCGGCAAGGC CCTCGACGAGCTGGACAAGGCAGTCCGCGAGCTGCAGTCCCAGCAGTAGGGGCGGGCTGGGAGCCCTAGGATGGGATCCC CAGCTGGGTGACCGCATGGCCGCCCAGTAGCTAGCCCCCTGATCGCCCGTTGGTCGCGGCGCTCGATGGAAGAGCGCAGG CCAGCGGGCGATTTTGCTTTTCTATGAAGCCTTGTTAGGCTAGTCGATGTTGCAGACAGAGGTCAGCCAAGGAATTGGTT GAGTCTGTACTCGCAAGCGT CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCGA ATCCTGCCCCCGCTACCA ACTTCCAAGCCCCTACCAGGAGAAACACTGGTAGGGGCTTTAGTTATTTCTCTTAAGGCCG GCGGATTCGGGTTAAACGACAAAATGTGTGTCTGACTCCGGCGTGTCGCGGGGTTAGATGTGGCCTTTTTGGATGCCGAT TGAGTGTGTGTAGTCGGTGTCGATAGCGTTGTCGTAGAGGGCTGGTCGTCCAGTTTCGTGGTCGGCTTGGTTCTCGTTGT GGGTCAGGGTGGATACTTTGGCGAGTTGGTCCTGGCCCCAGTTGGACTGCCTGGCGATCTCAACGGGGCCGTCAGGCAGT TCCGTTTGCAGGTACAGCCACCAATCCAGCATCCGGCGTTGGTGTTCACCGGATCTGCCGCGGTGGGTGCGGGCAAGCAG TTTCAACTGGGCGTTGATGCCGCCTTCCAGGCTGTTGGTGGTGGATTTGATCCGGCTGACATCGAGGACACCGTCAGGTG GGTCGAGATAGACAAATAACAGCTGGTTGCGCCATAGG