TRNA9

Coordinates:698822-698893

>TRNA9 Anticodon: TTG
TCCCCCATGGTGTAATTGGCAACACTGCGGTTTTTGGTACCGTCATTCTAGGTTCGAGTCCTGGTGGGGGAG

>TRNA9 Anticodon: TTG
TCCCCCATGGTGTAATTGGCAACACTGCGGTTTTTGGTACCGTCATTCTAGGTTCGAGTCCTGGTGGGGGAG


Corynebacterium urealyticum DSM 7109

Sequence spaning coordinates : 698322 - 699393 (Additional range around TRNA9 is :500nt.)

>Corynebacterium urealyticum DSM 7109 TCGGGGAGATCCGCTCGTGCGGCAGGGTCTCCCAGGCGGGCATGAGCTCCACCTCGTCGCCCAGCATGGCCTTGAGCTGC TCGGTGAGATCCTCGGCCTGCCGGGCGGTCGCCGTGATCACCAACACCGGAGCGTGCTGGGCAATGGTGCCGACGGCGAA GGGCCACACCGCGTCGGGGCCCTGGATCGCCAACTGCGCGGCACCGACATGGGTGACCAGGCCCTTGAGCTTCGAGTCGC GCGCGGCGGCCCGCAGCACACCCGACAGCGCGGGAGCCGCGTGCCCCTTATTCCCTGGTGCGGACGTATTTTGGCTTGCC GATGGGCGGACCGTGGTACTCATAGCGCCCCAGTGTAGCCGTGGGGGCAGACACCCCCGCGCCTAGCCTGCACCGTCCCG TTGCCGTGGCGCTTCGGTGATTTTCCACCCGCCGTGTGGCATGGGGTAGGGTGTTAAGCCGTTAGCGTCATCCTGCGGGA TCTTCGACGACTAGCGTTT TCCCCCATGGTGTAATTGGCAACACTGCGGTTTTTGGTACCGTCATTCTAGGTTCGAGTC CTGGTGGGGGAG CATGACGAGCGAAGACCAACAAGCTCAGGCCCCTACTCACTCCGAGCAGGGGCCTTTTTTCGACGCG CCTGTCCCACAAGCTGATCGGTAAGCCACCGAAGTCTGATCTCCCGAACGTGGAGCACAACGGCCTGCGCTTCTCCACGG CCTTTGGTTTCCAAAACATCGGCGACCAGATCATGAGCGCGAAGACGACGCTGCCGTGGTTGCTGCAGATGCTGGCCGCG CCCACCTGGATCGCGCCGCTATTGGTGCCGATCCGCGAGGCCGGCTCGATGTTGCCGCAGGCCGGGCTCCGCCCGTGGGT CCAGGCCCGCTCCCGTCGATTGCCGATCCTGCTGCTGGGCACGCTGGGTCAGGCGCTGGGCTGCATCATCGCGATGTGTG CAGCCCTGTTCACCTCCGGCACGACCGCTGGCCTGCTCATCCTCTTCGGCCTCGCGCTGCTCGCCGCCGCCCGTTCGCTG GTGTCGCTGACGAGTAAGGACATCCAGGGCCGC