

>tg0002 Glycosyltransferase, family 1

>tg0002 Glycosyltransferase, family 1

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1692 - 3834 (Additional range around tg0002 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTAAATGATGCATTAGTTTGTGCTGTAATGAATAATCTACCCCATTTACTTAGATTTGAGGATAAAAATTCAATGAGAT GGTCAATTGAAACAAGAGTCCCTTTTCTCGATCCAGAGCTTGTTGAATATGCACTTTCAACACCATCACAGGCAAAAATA AGAAATGGGATTACAAAATATATTCTAAGAGAATCCTTGAAGGGCATTGTTCCAGATATAATCTTAGATAGAAGAGATAA AATTGGATTTGCAACTCCAGATAATGAAATAGCAAATCATCCAGAGATCAAAAAATTTATTTGGAATATTATTAACTCAG AATCATTTAAAAAAAGAAAATATTGGAATTGGAAAAAAGTACACAAAGTATATTACCATCATAGCACATCGAAGCTAGGA AATATATTTATTGGAGAACTTATTTGGAAGGTTGTTATCCTTGAACTTTGGTTACGAGTGTGGATCGAAAACAAAAGTGC CCGAAGAGAGGGATGAAATT atgaaagtgtgcatgattactacagttcataagccacttgatggtaggatattttacaa agaagcaagaagcttatcaaaaatttacgatgtacttgtaatagcagctaacagggaggcaggggaaaggcaggtcgaga gtgttaaaatagttactataaaaagaccaaggcttaggaagctatttcattttattacaatatggagaatctttaagaaa gggttggagttggattgtaatatttatcattgtcatgagccagattctcttattatatgtcttcttatcaaattcataaa aaggaataatgtgaaggtaatatatgatgttcatgaacactggccaagtgaaataagatatgggtggttaagagtaaaaa ataacaaaattttaaccacgataatcgaaaaactaatttggaacattgagcacaaggccgttaattttgcggatcatatt atagttgtgaataatcatcttgcaagagaattccacatgttatccttcaaggtgtctgtaatacccaatgtgccattgat aacgatcctgaaaagaagctatagtggtgacataaataagaaagatgcagatttaattttaatggcctctaaagtggcta atcactatggtataaatgaaatcctacgctctctatacaagttaaaaaaagtatatcccaagattaaattgaaaataatt ggagatatcaaaattgatataaaaaccactttagacagattcaatatgacagacaatgttatattaaaaggtttcttacc tctagagaatatgtattatgaaatagaaaagggaaagataggattgaatatcgtgaagccggaattttataatatttaca taggattgtcaactaagctttttgattacatggcttgtaagttgcctgtagttgccagtaatttgccagaaattaaattg atcattaaacaaactaaagggggaattcttgtcgatccagaaaatatcaacgaaattacaaaggcaataaagtacttgat tgagaacccaaaggatgctaaaaaaatggggataagaaatagaaaagttattgagaagaacattaactggaaaagaagtg aaaaaaaattaattaggatatacaagctcttggaggaagggaaa TGAAAAATTTAGAATCTAACAAAAATGCAATAATC ATTGCCATTTTGTTACCATACTTACTGATAATAGGATCAGTTGCTAGTATTGTGGTGACTATCTATTTGAATAAACTAAA TTTCGCGATTAAAGGCTCTGTGGTGGTTATTCCAGCAGTCCTTTCAGCCTTAATGCTGTTCCAAGGTTATAACATGAAAA TAAGTTCATATAATGAAAGAAAAAAGTCTATATTTTTGACATGTCCTCAAAGAAGATTGATATTGCTGTTTTTTATACTA TTTCTATTGTCAATTCTTATCTTGATATTAGCACCATATCGTCCTTGGTATTATTTTGTGTTAGTGGCAATATTGTATAT TATAGTATTTCTCCAGATTCTCTCTAAAGAACCTGTTTCTTTTATGATATTGCTTGAACTTATTTTGATTTTAATAGAAT TGATTTATGGAACAACCTTCAAATATCCGCTATATTTTGGAGCAACAGATATTCCGGGCCATAT