

>tg0003 hypothetical protein TGAM_0003

>tg0003 hypothetical protein TGAM_0003

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 2834 - 5756 (Additional range around tg0003 is :500nt.)

>Thermococcus gammatolerans EJ3 CTACGCTCTCTATACAAGTTAAAAAAAGTATATCCCAAGATTAAATTGAAAATAATTGGAGATATCAAAATTGATATAAA AACCACTTTAGACAGATTCAATATGACAGACAATGTTATATTAAAAGGTTTCTTACCTCTAGAGAATATGTATTATGAAA TAGAAAAGGGAAAGATAGGATTGAATATCGTGAAGCCGGAATTTTATAATATTTACATAGGATTGTCAACTAAGCTTTTT GATTACATGGCTTGTAAGTTGCCTGTAGTTGCCAGTAATTTGCCAGAAATTAAATTGATCATTAAACAAACTAAAGGGGG AATTCTTGTCGATCCAGAAAATATCAACGAAATTACAAAGGCAATAAAGTACTTGATTGAGAACCCAAAGGATGCTAAAA AAATGGGGATAAGAAATAGAAAAGTTATTGAGAAGAACATTAACTGGAAAAGAAGTGAAAAAAAATTAATTAGGATATAC AAGCTCTTGGAGGAAGGGAA atgaaaaatttagaatctaacaaaaatgcaataatcattgccattttgttaccatactt actgataataggatcagttgctagtattgtggtgactatctatttgaataaactaaatttcgcgattaaaggctctgtgg tggttattccagcagtcctttcagccttaatgctgttccaaggttataacatgaaaataagttcatataatgaaagaaaa aagtctatatttttgacatgtcctcaaagaagattgatattgctgttttttatactatttctattgtcaattcttatctt gatattagcaccatatcgtccttggtattattttgtgttagtggcaatattgtatattatagtatttctccagattctct ctaaagaacctgtttcttttatgatattgcttgaacttattttgattttaatagaattgatttatggaacaaccttcaaa tatccgctatattttggagcaacagatattccgggccatatattcttgacaaaagtaacatatctatccgggcatattgt tccaccagatttaaatctttactacacatattttccattatatcatatatttatatcacagggggcatatattttgggat cagacataaagacttcgttatttcttattcttccaattccgtacgttataacggttttgttaatatattttttgtttaat ggtatctcaaaaaacagaagaatttcccttttatcatcgtttttttattcaaatagttatattataacatattatgggac ttacttggtaactagggccatagcctttgtggggtttgctattttgttatatttactctatagagagatatcacgcaaga gttataagtataagttgactatagtttttataagtgtgtttatactattaatacataatgtttctataatacagattagt gttttgttagttgttatgcttataattgaatttatgtttgggaaactagtagatttatcttggaaattaattgttattat aaacactttatttattggatattggacttttgcttcatggagttttacagaatatttgataaaatctcatgtattaacat tatttcatacaagtcctttaatgagacatatatctattagtaattcatatttctttctgacacatattgacatatcaata gctaccttctttacattggtagggatcggctatatgttacaaactgaaaaacaagagcatgtccttgcatttggagttat gtctatttttgctgtaccaatgtatgtgcccaacccccttcaggcattgtggcaaacaggaagtttgctaagatttgata ggtttaaattatttgttactccatttatagcatttgcaattgcatgggggttttatgtacttaatttgcactatagtctt attaaagaagacaacattctaaaacgaaaaatatttgctctattacttgtactagttgttatgggatattcctttatgtc tattactatgcacgacaatgcaaatgattgtaaagatttcccgtggaaaaatcctagaacatatttcaacaaagaagagt tatatgggtttagttacattattgagaatgttcctagtaattcaacattatattctgactattatacctacagatttttt gaaccaatgaagaggtttagcttatctaactttttgggaattccttattatgtatctaggataattccaagtattgaaga tttacctgcatgtaaaggatatttatcttttagaaaagaagagttttttaatgaggggctttattttggtaaggtataca atattaaattatacaaaccgaataaaatcaatgtaataaagctagtttatctcttacaagaaaaaagtcggatatattca aatccctcgctggatatatacaga TAAAATTTACTCATCACACAATTTCGTAACTACACAGGGAAGGCTACTCAGTGTA CGATGTTCACTAAATTATTAACTAGTACCGTAGCTCTAAGTGACCTTAGGGTATCTTTTCTCTCTGCACACCTATTTAGT GGATAGTTCTCCCCTCAAATTCCATAGAAAAGAAACCAAATACAGTAAAACTTCCCCCTGAAAGCATCGAGTCTATCAAA AAGTAGATGTTGACAAGTAAAATGAAGCACCCCCTTGATATTTTGGGTCTATTATTCCATCCTAAATAATAAAAGTAAAA ACATTAGAGCATAAACAAGGTTGAACCTTTAAGTCAAATTATTATAATCATTTTGCTCTTTAGGTCTTCGGGTCTTCAGG AATTCCTTTAGTCTTTTCATATCTTCCCCTCTCTTCATACATATCCCTCAAAATGCTATAAACTTTTATGGAGAGTACTG ATGTTGATATCCAGTTAGTAGCTAAAGTAGCGATGGCCGCTCCT