

>tg0013 Glycoside hydrolase, family 57, putative

>tg0013 Glycoside hydrolase, family 57, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 13997 - 18740 (Additional range around tg0013 is :500nt.)

>Thermococcus gammatolerans EJ3 TAACTCGAATGCAGCGTGGGAGAGAGCTGTTTTCATAACGACGGCAAACGATGGATGGAATTATAACAAAGCTCACATCT ATGCTGATTACAATGAATTTGATATTTATGATCCTAGTTGGAACGATGTAGGAAGTCATAACTCCGAAGCAGTCATAGAT GCAGATAATGACGTTATTGAGATGAAACTGTACAAAGGAGACTTGGGGATACAGGATTTGTCCAGTTCTACCATTAGAAT AACTGTTTCAACAATAGTCCATGACTGGAGCACGGGTAATGCAGTCATTGTAGGGGATCAGAGTAATTCTAACGTTGTGG ATGTAATGACAACGGAATCAAGCACTTGGGACGAGGTCAGTGATGGCTACATTGACTACTACACTGATATCGACATCTTC CAGGTGCCTTTCTTCAGCAACCTCGCGGTTGTTCTGGCGTTTGTCTTGGGTGTGGTGCTGCTCTTCAGGAGGCTCTGACC CTTTTATCTTTCTTCCGTT ttgctcgcttctcggagtaaaccttttgaggatgcagagaatatatcactcaaggtgatg acaatgagggctttagcgggtgttgtagctgccatggtgatcctctcacttctacctcagaatataatcccgggcgtctc agcatacccatccgccgacgggagtccttttgactgggtctacgacaacgtaaaggccctcgatggccacgacgacctct ggcactggtacaacgacggggacgactatgcgagggatctaatagctttctactactccgagaaccccgacacggtaacc atgaggatagacctcatggagcttgacgtgggtgaagagtccaatgccaactggtacatcctcatggacttcgccgccgg cggccagaatgcactccccgacggtttaaccgatgcgaatgggaataccctcagcactggcatggcctgggatatagcca tagcagtgtacgattcctctaactacaacgtctacttcccggactggagcgtccacaacgatgtcgttaaggccgtaacc ctgaacgccgagtacgacttcatcgatgtcgagctgtacaaggataagataccgaacttcccgtcaggggggcaggttca cttccaggttctctctgccaaggacttttccagcccgtaccgggtcactgactcgatgcccgacgacatccagtactatt tcaccagcgatgaccgggtggggacggccaaggtcgtctttgtgcaccacgcgaaccagcacattgcgtacagtgagtct gacgtctgcgggggcgagggtacgggttacgacgacgttataaggacgcacctccagtaccgtgttccccttaacctgca cctcagcggtgttcttcttgagaacctgatatggaacgactacacctgcggggccgataacttcatccagatgattagat acggggtgaactcgggccttataggcatactcacctctgcctacggtcagcagataatgcccttcttcccgcaggatctc aacgttaagagcctcggcatggagaacgcgctcatatgggaactgttctcgtacactcccaaggttgcgtgggtgccgga gagggtctgggagaccaagctcagtgatggtgatccctacaacggcgttaagagcgacccgtgggattattttgcggcca cgaatccagccaacggtctgccttacgccgaggcggttgtattggatgccaacactcatggaacgggcaaggatgccaat ggaaaccccatcaatccctacaagatatacgaacttccaaatggcaagctgaagatattcttcatagacgactggcttaa ggacaccatatacagttcgaatgattgggattccgatagctggacgagtatcaagaaacactggcttgatttcgctttga gccccgaccaggagcagatagacgtctacgcggacgaccttgagaaggccgctggtgttgctgggtggccaaccaatcct caggattacttttatgccgtgaggtatgttgcggctcatccttggatccgggccgttaagcttgatgacgttctctcgtg gagctccggtgagggtggccgtttctggggcgatggtggtgactactggccggttgcgggaacgtacagggagatagggg ggaccaatggatacggtggcacgggcgatgtgaacggcgatggaactcctgatagaaacgcttggtacaaggactgggcc atcaactattacccctacaactgccctaagtctgcaggtaccctgtggtgggaggtttaccaggagcttgagaacctgaa gaatgtgggggttgacaacaacctcgttgacctcgcctggacgacgctgatggcgaacctctacgagaccggctggcatg acgggcttggtgggtcgctgagcggctgggagaaggaaattagctcccacctcaggcacgccctcccctatgcctacggg gcatggtggttgagcaacaccaacaagccccttctggcctattggaaaaacgttgatgaggacaacgacaacgagatcgt tgtccagaacgacagactttatgcagtcctcgatcccatcggaggcagggtagggtggctctttgattcgaacgggcacg ttgtcatcggcaactctatggcgctctggagcggcacggagggcgactacaacgacggcaaccacgtctggggccttagc gatgcctacgatggtggaacttacgagcacagctattaccagcttgagatcctggaagacggaactaacggaaggattct agtccggacaaagagtccgggagggtttgttaagtacattgagctcagaaaaggctggagctacctcaaggtcacataca gggacgtcagcaggaggatatacgtgaagaccggcttctcaccggggctgagcgatctgctgaggaacgggaagaagaac atcgagcgcgtctggctctacgatggaaaggttgcaggctactacaacagggaaacggacactcttggggcgtacgtcct tccggggccagtctcattcaaccggggcgaggactggagaactctcacagttgctgacgagataaagcttgagtcggacg ggactttctacatctacgccggcccgtggaacgcctcagtctttggagagcttttgagcgagccacttagaggcagtgtt tcattctcacctgagcgtccttcggctggagatactgtgacgatatactacaacgccagtggcgggccccttgaaggagc cacttccttaactcttcactggggccacgacggctggaaggacgtcaccgatacgcccatgcagtactcgaacggcgtct ggaaggttgccattgagacgcagggctcctggggctcccttgacttcgtctttaccaatggcagcgtctgggacaacgac ggttggagggactaccacatatacctaagtcctcccagcgttccggcaagcgtctccgatcttttaacaggcgatgagtg cagctggggctcgtaccttcccgcaccaaacagtggtgaagtaaaggacggagaatacgtctggcacgatgccaatgggg acgttcactcgacgaaaaactatccccatcctgaggacaactacgacatcgagagcgtaagggtcagggccgatagggac tacgtttacttctcaatcaggctctcggatttggcttccattggagagtttggggctcctctcatcgcaatcccgataag cgtcggcactgggactaaccacaccattccatacgacggctctctgagctattcccccggctgggactactgggtggtcg ttgatctctccaaggcaggctttccagatactgagatacttggttctcctgcggtggaggtttatgattcctcattctcc aagctggctggggactactacgctatagcctccaaaaccaatagcgtgatccaggtggcgattcccagggaactcctcgg caacccatcgagcttgggctttaacgtcctggtcttccttggagacagcaggggaggtgccctcgatcccggctcaccga aggtagttgacctcatgagcccgtcatcaactgacggggaactcagcgacggtagcatagactatgcggcagacgttgac ctgactgccgtgctcttctttggatattcccccttgatagtgggggctttactggtcgttttggcctttgctttcaagcg ccac TGATGTTCTCTTTTTTCTTCCCGTAACCCACCACCAGTAGAGGAACACGTAGGCGACGAACATGAGATCCCCCAG GTGGGAGTGGAACAGTTCCAGAAACGAAACCCCTGTGTAGTAGCCGATGACCAGGAGGATGAATATCCTCAGGGCGTTGA GCGGGATGATTCCTACCGCCCCGAGGAGCAGAAGGGCCGCCTCCCTTCTGGAGGATTTCCTCATGTAGATCAGAAGCAAG GAGGCCAGGATGTAGATGACGAAGGCGTCAAAGCCGGAACAGCCCGAGCCGATTATCACGATGGCCTTTCCCACAACTGC GATGTTTTTGTTGATCTTTATCGGAATCCCGGAGAGCTCTACCAGCCCCTTGACCAGTATCGAGGTGACGTCCACGAAGA GTCCGCTTGTTATGTCTATCACCTTTCTGATTAATCCAGTCTTGGATGAGAGCGCTACGGCAGCTCCGCCAGCCGCCACG GCCAGGGGCATCTCAAGGCCTTTTA