

>tg0014 hypothetical protein TGAM_0014

>tg0014 hypothetical protein TGAM_0014

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 17765 - 19733 (Additional range around tg0014 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCAGCTCCCCCTTTATCCTTTCGAGAGTTATCCAGGGGATCCAGGGCTCGAAGGCCTTTGAGCGGCGGTATATTGCTAT GAGCGCAAGGGCTACGTTGAAGATGGTTAAGCTGACGAGGATAGGGATGAGCCTTATGCCCCAGGGGGTGTAGTTCAGAC CGAGGCCTATTAGAGGGACTATCGCTATGCTCAGGCCGAAGCTTAACGCCAATCTCTCAAGGTTGTCAAGCTCCTTTCTT TCGGGAAAGAGGGCGGTTATGAAGACATAGCCCGGGAAGAAGAGGACGAAGGCCAAGCCGAGGCCCTTTCTCGCCAAACT GTTCGGGGCGTAGAATATGAGGACGTCAAGGATGAGTGAAAGCCCTATGATTATGAGAAGGTCCCAGTACTTCCAGATGC CCTTGGGCTCTTCCATTCGACCACCTTCTCATGAATAAAAAGGTGGGTTAAAATGGTTTTGGTTTGTTGGCATTCCTTGC TCCGAAAATGGTTTAAACT ttgagtgtacaaattctatggaggatatcacccggagggatacaaatgaaaaaagccgga ttgttcttggcaatgctcttgatgttgagtgtggccgggttcgtcagtgctcatcagataactgtggacggttcgcctac ggactggcaggcggacacttcaacccagaacgttaacacctggcatctttacagcaacgctggcgagtgggtctggaagg acgcaacgggagacgttcgaaccgatattcaagattgcaatccatgtgatcctggggatactgatataactgagatcagg attaccagtgatcaggattatgtgtacatcttggtcaagtttagggacataaataaggtaggagggtatctagaggatga aactgagccctttgggaactccaagagaggacttggactgataataacgatagacaccgaccagcaatcaaattctgggc aaacttggcttccaaagtactcgaacacccaagttaactcgaatgcagcgtgggagagagctgttttcataacgacggca aacgatggatggaattataacaaagctcacatctatgctgattacaatgaatttgatatttatgatcctagttggaacga tgtaggaagtcataactccgaagcagtcatagatgcagataatgacgttattgagatgaaactgtacaaaggagacttgg ggatacaggatttgtccagttctaccattagaataactgtttcaacaatagtccatgactggagcacgggtaatgcagtc attgtaggggatcagagtaattctaacgttgtggatgtaatgacaacggaatcaagcacttgggacgaggtcagtgatgg ctacattgactactacactgatatcgacatcttccaggtgcctttcttcagcaacctcgcggttgttctggcgtttgtct tgggtgtggtgctgctcttcaggaggctc TGACCCTTTTATCTTTCTTCCGTTTTGCTCGCTTCTCGGAGTAAACCTTT TGAGGATGCAGAGAATATATCACTCAAGGTGATGACAATGAGGGCTTTAGCGGGTGTTGTAGCTGCCATGGTGATCCTCT CACTTCTACCTCAGAATATAATCCCGGGCGTCTCAGCATACCCATCCGCCGACGGGAGTCCTTTTGACTGGGTCTACGAC AACGTAAAGGCCCTCGATGGCCACGACGACCTCTGGCACTGGTACAACGACGGGGACGACTATGCGAGGGATCTAATAGC TTTCTACTACTCCGAGAACCCCGACACGGTAACCATGAGGATAGACCTCATGGAGCTTGACGTGGGTGAAGAGTCCAATG CCAACTGGTACATCCTCATGGACTTCGCCGCCGGCGGCCAGAATGCACTCCCCGACGGTTTAACCGATGCGAATGGGAAT ACCCTCAGCACTGGCATGGCCTGGGATATAGCCATAGCAGTGTACGATTC