

>tg0016 Glycosyltransferase, family 1

>tg0016 Glycosyltransferase, family 1

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 19798 - 21904 (Additional range around tg0016 is :500nt.)

>Thermococcus gammatolerans EJ3 ATGGGGCTCCTAGATGACTACTTGAGCAACGGGAACAGGGATTCACCGGGCTACTTTGTCCAGTGGCTCCTCGAAAGGGG GGAGCCGATTAAGGCCTACCGCTTCTCCGAGTACTGGTACGACATAGGGAGCGCGGACAGCTACCTCGAGGCCCTTAAAA CCCTTCTCAGGGAGAGTCATATCGAGGAGATTCAGATAAGCCCCTACTCAAAGATAATCCCTCCTGTGGTGATAAAGCGG GGGGCGAAGATACTTGGACGCTCGATTATAGGGCCGTTCGCCTACATTGGCGAGGAGTGCGTCATCGAGAACTCCGACGT CAGCGACTCGATAATCTTCAGAAAGACGATAATCAGGAACTCGACGATATGGCGCTCCATCATAGACGAGAAGTGTGAGA TAAGGAACCTCGAGCTCAGGAAGAGCCTCGTTGGGGGTCACGCGAAGATACAGAGGGGAGAGTGAAAAGCTTTTAGTCCC ACTCCTCAATCTCTTCACA atggagacgctgaagatagcattcgtctacgacgtcgtttacccatgggtcaagggaggc gttgagaggagaatctacgagctcgccaagaggctggctagggatcatgaggttcacgtttatggctacaagcactggga gggaaagaacgagatagagcgggatgggattcactatcacggtcttgcccccgcgccaaaacggctctaccttctcggaa agaggaaccccctgcccatgctgcgccttgcatcccgtctgcgccgtagaatcggggagtttaggtggtatgacatcgtt gacgtccagaacctcttctatccgggggccctagcgctgaaaagtcttcccagcactgttattacatggcacgagttctg gggcccttactggtggaggtatcttggtcccggaggtctcccaggatggctctcggagcgagctctttttacggcagaac accatatctccgtctcatggaagaccaagcacgaccttctccgggccggactcaggaagcccgtgcccgttgttccaaat ggcgttgatgttgagttcatacaggcaattccgccggatgagctcgagtcggacgtcatattcgtcggccggctgatctc ggagaagggcgttgattttcttctgaaggcgctggtgaaggtaaaggaggagctcccggacgttagggccgtgatagttg gcggcgggccggagagaaaaagactggaacgcatggcaaagggtttgggcctcgaaaaaaacgttctctttacgggtttt ctgccttacaagagggttatagctctgatgaaggcttccaaggtcttcgttcttccgtcgctgagggagggctttgggat ggtggcgcttgaggcaatggcctgtggcctgccggtagttactcttaacgcgccgatgaacgccgcgaggtttctggttg aggatgggaagaacggtttcgtcgtggatgagagccagctctcagatactctggcgtctctgctgtttgacaaagctttt ttaaagctgattggtcgggttagccgcgagatttcggcggaatacgactgggacgccgttgtaaggctactccttgacgt gtacgtt TAGCTTCAGGCTCTGTATCGTCCCGTTGATGGCCTTCAGTATCAGGTTCCTTGTCTCGGTTTCGGCGTAGTT GCCGTCCGGGGGTGCGGGCGGAAGTTTTGGTTGGTTGTCCTTGAAGAGGAGGAACCAGACTTGCCAGTCACCGGGTCTCT TGATGCTGAAGGTGTAGTTCGTCTCGAACTGGGGCGTCCAGTTGCCTTCTATGTTGATCGGAACGTTCGGCAGGGTCACG TTGAACCAGCCCGGCAGGGGATACATCTCGTAGATCGTTGTTGTGTTCGTTTGGTTCTCCCACGTCAGGTTGACCAGCCA TATCTGGACGTAGTAGGTAACGTTCCTACCCTCGTGGTTGACGATGCCTATTATAACCTTCCCCTCCTGGCCGACTTTGA GCTCTGTGGGGTAATCTGAGGCCTTCCCACCCGGCCCGAGGATGTAGAACTCCGTGAAAGCCTCTCCGGGCTTCGGGTGG GTTATAACGTAGGTTAGGGTTCCTATTG